comGA

168

late competence protein, traffic ATPase, binds and transports transforming DNA, required for growth arrest of competent cells

Locus: BSU_24730

Molecular weight: 40.30 kDa

Isoelectric point: 8.89

Protein length: 356 aa

Gene length: 1071 bp

Function: genetic competence

Product: traffic ATPase

Essential: no

Synonyms: comGA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2804 (Galperin et al., 2021)

Gene

Coordinates: 2,559,007  2,560,077

Phenotypes of a mutant

• loss of genetic competence

The protein

Catalyzed reaction/ biological activity

• binds and transports transforming DNA
• sequesters MreB during expression of PubMed to inhibit cell elongation during escape from competence PubMed

Protein family

• GSP E family (single member, according to UniProt)

Structure

• 4PHT (PDB) (from Vibrio vulnificus, 38% identity) PubMed
• P25953 (AlphaFold)

Modification

• phosphorylated on Arg-28, Arg-71- and Arg-330 PubMed

Localization

• peripheral membrane protein PubMed
• localizes to cell poles in competent cells PubMed
• localizes to one cell pole, this depends on ComEB PubMed

Additional information

• ComGA stability depends on Maf PubMed

Expression and Regulation

Operons

• Genes: comGA-comGB-comGC-comGD-comGE-comGF-comGG-spoIIIL

  Description: PubMed

  Regulation

  • expressed early during sporulation in the forespore (SigF) PubMed

  Regulatory mechanism

  • ComK: activation, PubMed, in comK regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigF: sigma factor, PubMed, in sigF regulon

  Additional information

  • the ''comGA-comGB-comGC-comGD-comGE-comGF-comGG-spoIIIL'' operon requires NusA for expression Reference

Biological materials

Mutant

• BKE24730 (comGA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTTGATTCCCTCTCCTT,  downstream forward: _UP4_TAGAAAAGTCTGGTTGTTAA
• BKK24730 (comGA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTTGATTCCCTCTCCTT,  downstream forward: _UP4_TAGAAAAGTCTGGTTGTTAA
• BP914 ((comGA-comGB-comGC-comGD-comGE-comGF-comGG)::phleo), available in Fabian Commichau's lab

GFP fusion

• GP1640 trpC2 ''ymdB::spc PcomG-gfp (cat''), available in Jörg Stülke's lab
• GP1643 PcomG-gfp (cat) in the NCIB3610 background, available in Jörg Stülke's lab
• PG389 amyE::(pcomGA-lacZ gfp cat) PubMed, available in Leendert Hamoen's and Jörg Stülke's labs

References

Reviews

Loading

Original Publications

Loading