cotY

cotY
168

main structural component of the spore crust, necessary for the assembly of the spore crust, the outermost layer of the spore coat

Locus
BSU_11750
Molecular weight
17.74 kDa
Isoelectric point
4.86
Protein length
Gene length
Function
spore crust assembly
Product
spore crust protein (insoluble fraction)
Essential
no
Synonyms
cotY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5888 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,250,016 → 1,250,504
The protein
Structure
Paralogous protein(s)
spore crust PubMed
localization requires CotZ PubMed
Expression and Regulation
Operons
Genes
Description
Regulation
expressed late during sporulation in the mother cell (SigK) PubMed
Regulatory mechanism
GerR: activation, PubMed, in gerR regulon
GerE: activation, PubMed, in gerE regulon
Sigma factors
SigK: sigma factor, PubMed, in sigK regulon
SigE: sigma factor, PubMed, in sigE regulon
Open in new tab

cotYcotZ

2025-08-14 17:08:29

ghost

72

d5352cc528c9d84dd78f9c0efc66e2b6f4d516ce

FC77A0E4A305752E4BFB18C6B5B61BE0A0A39C5D

Biological materials
Mutant
BKE11750 (ΔcotY::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATTGATTTCAGCTCCTTCT,  downstream forward: _UP4_TAAACACTTGTAAAGAGGAA
BKK11750 (ΔcotY::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATTGATTTCAGCTCCTTCT,  downstream forward: _UP4_TAAACACTTGTAAAGAGGAA
References
Reviews
Driks A, Eichenberger P The Spore Coat. Microbiology spectrum. 2016 Apr; 4(2). doi:10.1128/microbiolspec.TBS-0023-2016. PMID:27227299
McKenney PT, Driks A, Eichenberger P The Bacillus subtilis endospore: assembly and functions of the multilayered coat. Nature reviews. Microbiology. 2013 Jan; 11(1):33-44. doi:10.1038/nrmicro2921. PMID:23202530
Original Publications
Lablaine A, Juillot D, Condon C, Carballido-López RReal-time nanoscale investigation of spore coat assembly in Bacillus subtilis.Communications biology. 2025 Jul 30; 8(1):1131. PMID: 40738962
. . PMID: 39817517
Ursem R, Swarge B, Abhyankar WR, Buncherd H, de Koning LJ, Setlow P, Brul S, Kramer GIdentification of Native Cross-Links in Bacillus subtilis Spore Coat Proteins.Journal of proteome research. 2021 Feb 17; . PMID: 33596081
Bodík M, Krajčíková D, Hagara J, Majkova E, Barák I, Šiffalovič PDiffraction pattern of Bacillus subtilis CotY spore coat protein 2D crystals.Colloids and surfaces. B, Biointerfaces. 2021 Jan; 197:111425. PMID: 33099149
Bartels J, Blüher A, López Castellanos S, Richter M, Günther M, Mascher T The Bacillus subtilis endospore crust: protein interaction network, architecture and glycosylation state of a potential glycoprotein layer. Molecular microbiology. 2019 Sep 10; . doi:10.1111/mmi.14381. PMID:31502725
Shuster B, Khemmani M, Abe K, Huang X, Nakaya Y, Maryn N, Buttar S, Gonzalez AN, Driks A, Sato T, Eichenberger P Contributions of crust proteins to spore surface properties in Bacillus subtilis. Molecular microbiology. 2018 Dec 24; . doi:10.1111/mmi.14194. PMID:30582883
Krajčíková D, Forgáč V, Szabo A, Barák I Exploring the interaction network of the Bacillus subtilis outer coat and crust proteins. Microbiological research. 2017 Nov; 204:72-80. pii:S0944-5013(17)30469-X. doi:10.1016/j.micres.2017.08.004. PMID:28870294
Liu H, Krajcikova D, Wang N, Zhang Z, Wang H, Barak I, Tang J Forces and Kinetics of the Bacillus subtilis Spore Coat Proteins CotY and CotX Binding to CotE Inspected by Single Molecule Force Spectroscopy. The journal of physical chemistry. B. 2016 Feb 18; 120(6):1041-7. doi:10.1021/acs.jpcb.5b11344. PMID:26821119
Arrieta-Ortiz ML, Hafemeister C, Bate AR, Chu T, Greenfield A, Shuster B, Barry SN, Gallitto M, Liu B, Kacmarczyk T, Santoriello F, Chen J, Rodrigues CD, Sato T, Rudner DZ, Driks A, Bonneau R, Eichenberger P An experimentally supported model of the Bacillus subtilis global transcriptional regulatory network. Molecular systems biology. 2015 Nov 17; 11(11):839. doi:10.15252/msb.20156236. PMID:26577401
Liu H, Krajcikova D, Zhang Z, Wang H, Barak I, Tang J Investigating interactions of the Bacillus subtilis spore coat proteins CotY and CotZ using single molecule force spectroscopy. Journal of structural biology. 2015 Oct; 192(1):14-20. doi:10.1016/j.jsb.2015.09.001. pii:S1047-8477(15)30056-3. PMID:26341943
Jiang S, Wan Q, Krajcikova D, Tang J, Tzokov SB, Barak I, Bullough PA Diverse supramolecular structures formed by self-assembling proteins of the Bacillus subtilis spore coat. Molecular microbiology. 2015 Jul; 97(2):347-59. doi:10.1111/mmi.13030. PMID:25872412
Imamura D, Kuwana R, Takamatsu H, Watabe K Proteins involved in formation of the outermost layer of Bacillus subtilis spores. Journal of bacteriology. 2011 Aug; 193(16):4075-80. doi:10.1128/JB.05310-11. PMID:21665972
McKenney PT, Driks A, Eskandarian HA, Grabowski P, Guberman J, Wang KH, Gitai Z, Eichenberger P A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat. Current biology : CB. 2010 May 25; 20(10):934-8. doi:10.1016/j.cub.2010.03.060. PMID:20451384
Krajcíková D, Lukácová M, Müllerová D, Cutting SM, Barák I Searching for protein-protein interactions within the Bacillus subtilis spore coat. Journal of bacteriology. 2009 May; 191(10):3212-9. doi:10.1128/JB.01807-08. PMID:19304857
Johnson MJ, Todd SJ, Ball DA, Shepherd AM, Sylvestre P, Moir A ExsY and CotY are required for the correct assembly of the exosporium and spore coat of Bacillus cereus. Journal of bacteriology. 2006 Nov; 188(22):7905-13. . PMID:16980471
Steil L, Serrano M, Henriques AO, Völker U Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology (Reading, England). 2005 Feb; 151(Pt 2):399-420. . PMID:15699190
Kuwana R, Okumura T, Takamatsu H, Watabe K The ylbO gene product of Bacillus subtilis is involved in the coat development and lysozyme resistance of spore. FEMS microbiology letters. 2005 Jan 01; 242(1):51-7. . PMID:15621419
Zhang J, Ichikawa H, Halberg R, Kroos L, Aronson AI Regulation of the transcription of a cluster of Bacillus subtilis spore coat genes. Journal of molecular biology. 1994 Jul 29; 240(5):405-15. . PMID:7519271

B2636947990A303C43CEA8BFBE38811DD233A0A6

Page visits: 4479

Time of last update: 2025-08-14 22:38:05

Author of last update: Jstuelk