cysJ

168

sulfite reductase (NADPH₂) (alpha subunit)

Locus: BSU_33440

Molecular weight: 67.08 kDa

Isoelectric point: 4.57

Protein length: 605 aa

Gene length: 1818 bp

Function: sulfite reduction

Product: sulfite reductase (NADPH₂)

Essential: no

Synonyms: cysJ, yvgQ

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Additional metabolic pathways, Sulfur metabolism

Metabolism, Additional metabolic pathways, Sulfur metabolism, sulfur metabolism/ general

List of homologs in different organisms, belongs to COG0369 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CysL regulon

Gene

Coordinates: 3,432,339 3,434,156

Phenotypes of a mutant

unable to grow with sulfate or sulfite as the only sulfur source PubMed
defective in the the ability to support the growth of Synechococcus leopoliensis CCAP1405/1 on agar media PubMed

The protein

Catalyzed reaction/ biological activity

3 H₂O + hydrogen sulfide + 3 NADP⁺ --> 4 H⁺ + 3 NADPH + sulfite (according to UniProt)

Domains

Flavodoxin-like domain (aa 68-206) (according to UniProt)
FAD-binding FR-type domain (aa 235-454) (according to UniProt)

Cofactors

FMN PubMed
FAD PubMed

Structure

5GXU (PDB) (from Arabidopsis, 32% identity)
O32214 (AlphaFold)

Additional information

belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

Genes: cysI-cysJ

Description: PubMed

Regulation

induced by sulfite, sulfate, and thiosulfate (CysL) PubMed

Regulatory mechanism

CysL: activation, PubMed, in cysL regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

1A802 ( cysJ::kan), PubMed, available at BGSC
1A934 ( cysJ::kan), PubMed, available at BGSC
BKE33440 (cysJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
BKK33440 (cysJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT

References

Loading