darA

168

c-di-AMP-binding PII-like protein, required for adaptation to osmotic stress

Locus: BSU_00290

Molecular weight: 11.83 kDa

Isoelectric point: 6.09

Protein length: 109 aa

Gene length: 330 bp

Function: adaptation to osmotic stress

Product: c-di-AMP-binding PII-like protein

Synonyms: darA, yaaQ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3870 (Galperin et al., 2021)

Gene

Coordinates: 39,871  40,200

Phenotypes of a mutant

• inactivation of darA facilitates the adaptation a strain lacking c-di-AMP to growth on complex medium PubMed
• the mutant is sensitive to extreme K(+) limitation and to salt stress PubMed

The protein

Structure

• 4RLE (PDB) (the B. subtilis protein in complex with c-di-AMP) PubMed
• P37538 (AlphaFold)

Effectors of protein activity

• binds c-di-AMP PubMed

Expression and Regulation

Operons

• Genes: xpaC-yaaN-yaaO-tmk-darA-yaaR-holB-ricT-yabA-trmN6-yazA-yabC

  Description: PubMed

• Genes: darA-yaaR-holB-ricT-yabA-trmN6-yazA-yabC

  Description: PubMed

  Regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase PubMed

• Genes: tmk-darA-yaaR-holB-ricT-yabA-trmN6-yazA-yabC

  Description: PubMed

Biological materials

Mutant

• MGNA-B897 (yaaQ::erm), available at the NBRP B. subtilis, Japan
• GP1712 (''darA::cat''), available in Jörg Stülke's lab PubMed
• GP1713 (''darA-yaaR::cat''), available in Jörg Stülke's lab
• GP2406 (''darA::ermC''), available in Jörg Stülke's lab
• GP2415 (''darA::spc''), available in Jörg Stülke's lab
• GP2497 (''darA::tet''), available in Jörg Stülke's lab
• BKE00290 (darA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT,  downstream forward: _UP4_CATCAATTTTAAGGATCTGA
• BKK00290 (darA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT,  downstream forward: _UP4_CATCAATTTTAAGGATCTGA

Expression vectors

• pGP2797: expression of darA (native RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab
• pGP3002: expression of darA (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab
• pGP2601: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab PubMed
• pGP1690: IPTG inducible expression, purification in E. coli with N-terminal cleavable His-tag, in pGP570, available in Jörg Stülke's lab
• pGP2624: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• pGP2602: expression of Strep-darA by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP2603: expression of darA-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP2847: expression of His₆-darA (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab
• GP2010: expression of darA-Strep in B. subtilis (chromosomal), suitable for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading