divIVA

168

curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum, cell division initiation protein (septum placement), part of the Min system (with Z ring placement)

Locus: BSU_15420

Molecular weight: 19.20 kDa

Isoelectric point: 4.85

Protein length: 164 aa

Gene length: 495 bp

Function: division site selection, chromosome segregation and control of peptidoglycan homeostasis

Product: cell division initiation protein, member of the divisome

Essential: no

Synonyms: divIVA, ylmJ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3599 (Galperin et al., 2021)

Gene

Coordinates: 1,612,521  1,613,015

Phenotypes of a mutant

• filamentation and polar divisions that in turn cause a minicell phenotype PubMed
• moderate PubMed to severe PubMed sporulation defect

The protein

Catalyzed reaction/ biological activity

• curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum
• DivIVA is required for polar localisation of MinC-MinD via MinJ. PubMed
• It also recruits RacA to the distal pole of the prespore PubMed.
• DivIVA may anchor SpoIIE briefly to the assembling polar septum before SpoIIE is subsequently released into the forespore membrane and recaptured at the polar septum PubMed
• required for the compartment-specific activation of SigF PubMed
• activates PrkC PubMed
• required for oriC placement during spore development PubMed

Protein family

• DivIVA family (single member, according to UniProt)

Domains

• the first 60 amino acids constitute a conserved lipid binding domain PubMed
• the C-terminal domain is less conserved
• multimerisation involves two coiled-coil motifs, one in the lipid binding domain, and the other one being present in the helical C-terminal domain PubMed PubMed

Cofactors

• not known

Structure

• 2WUJ (PDB) (N-terminal domain) PubMed
• P71021 (AlphaFold)

Modification

• phosphorylated on Arg-102 PubMed
• The Mycobacterium DivIVA homologue Wag31 is phosphorylated at T73 PubMed
• DivIVA from Streptococcus pneumoniae is phosphorylated at Threonine 201 by the Ser/Thr protein kinase Sktp1. PubMedPubMed

Effectors of protein activity

• not known

Paralogous protein(s)

• GpsB

Localization

• DivIVA forms a ring underneath the invaginating membrane at the site of cell division and is enriched at both cell poles PubMed
• forms rings at the division septum and patches at the cell poles PubMed
• membrane targeting requires SecA PubMed
• assembles into a ring-like structure at the foreshore face of the polar septum during sporulation PubMed
• mobility of DivIVA is reduced by its interaction with MinJ PubMed

Additional information

• about 1,700 molecules per cell PubMed

Expression and Regulation

Operons

• Genes: divIVA

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon

Biological materials

Mutant

• 4041 (divIVA::tet), available in Leendert Hamoen's, Jörg Stülke's, and Sven Halbedel 's lab
• GP1482 (chromosomal divIVA-Strep fusion, aphA3), purification from B. subtilis, for SPINE, available in Jörg Stülke's lab
• BKE15420 (divIVA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATGCCACCTCCATTTT,  downstream forward: _UP4_TAAATTCTCTGATTATCTTG
• BKK15420 (divIVA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATGCCACCTCCATTTT,  downstream forward: _UP4_TAAATTCTCTGATTATCTTG

Expression vectors

• DivIVA-Strep available here
• pGP1497 (N-terminal Strep-tag fused to C-terminus of divIVA, TEV-site, purification from E. coli, in pGP172), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Sven Halbedel's and Jörg Stülke's labs

FLAG-tag construct

• GP1776 (spc, based on pGP1331), available in Jörg Stülke's lab

Antibody

• A polyclonal anti-DivIVA antiserum generated in rabbit is described here PubMed.

GFP fusion

• divIVA-gfp fusions available from the Hamoen Lab

Labs working on this gene/protein

• Leendert Hamoen, Centre for Bacterial Cell Biology, Newcastle upon Tyne, United Kingdom x
• Imrich Barak, Slovak Academy of Science, Bratislava, Slovakia homepage
• Sven Halbedel, Robert Koch Institute homepage

References

Reviews

García-Heredia APlasma Membrane-Cell Wall Feedback in Bacteria.Journal of bacteriology. 2023 Feb 16; :e0043322. PMID: 36794934
Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
Ramos-León F, Ramamurthi KCytoskeletal proteins: Lessons learned from bacteria.Physical biology. 2022 Jan 26; . PMID: 35081523
Hammond LR, White ML, Eswara PJ ¡vIVA la DivIVA! Journal of bacteriology. 2019 Aug 12; . pii:JB.00245-19. doi:10.1128/JB.00245-19. PMID:31405912
Halbedel S, Lewis RJ Structural basis for interaction of DivIVA/GpsB proteins with their ligands. Molecular microbiology. 2019 Jun; 111(6):1404-1415. doi:10.1111/mmi.14244. PMID:30887576
Surovtsev IV, Jacobs-Wagner C Subcellular Organization: A Critical Feature of Bacterial Cell Replication. Cell. 2018 Mar 08; 172(6):1271-1293. pii:S0092-8674(18)30051-5. doi:10.1016/j.cell.2018.01.014. PMID:29522747
Wagstaff J, Löwe J Prokaryotic cytoskeletons: protein filaments organizing small cells. Nature reviews. Microbiology. 2018 Jan 22; . doi:10.1038/nrmicro.2017.153. PMID:29355854
Eswara PJ, Ramamurthi KS Bacterial Cell Division: Nonmodels Poised to Take the Spotlight. Annual review of microbiology. 2017 Jul 11; . doi:10.1146/annurev-micro-102215-095657. PMID:28697666
Strahl H, Hamoen LW Finding the corners in a cell. Current opinion in microbiology. 2012 Dec; 15(6):731-6. doi:10.1016/j.mib.2012.10.006. pii:S1369-5274(12)00130-0. PMID:23182676
Kaval KG, Halbedel S Architecturally the same, but playing a different game: the diverse species-specific roles of DivIVA proteins. Virulence. 2012 Jul 01; 3(4):406-7. doi:10.1111/j.1365-2958.2012.07969.x. PMID:22722244
Bramkamp M, van Baarle S Division site selection in rod-shaped bacteria. Current opinion in microbiology. 2009 Dec; 12(6):683-8. doi:10.1016/j.mib.2009.10.002. PMID:19884039
Juarez JR, Margolin W Irresistible curves. The EMBO journal. 2009 Aug 05; 28(15):2147-8. doi:10.1038/emboj.2009.167. PMID:19654604

Original Publications

Chareyre S, Li X, Anjuwon-Foster BR, Updegrove TB, Clifford S, Brogan AP, Su Y, Zhang L, Chen J, Shroff H, Ramamurthi KSCell division machinery drives cell-specific gene activation during differentiation in Bacillus subtilis.Proceedings of the National Academy of Sciences of the United States of America. 2024 Mar 26; 121(13):e2400584121. PMID: 38502707
Cramer K, Reinhardt SCM, Auer A, Shin JY, Jungmann RComparing divisome organization between vegetative and sporulating Bacillus subtilis at the nanoscale using DNA-PAINT.Science advances. 2024 Jan 12; 10(2):eadk5847. PMID: 38198550
Chareyre S, Li X, Anjuwon-Foster BR, Clifford S, Brogan A, Su Y, Shroff H, Ramamurthi KSCell division machinery drives cell-specific gene activation during bacterial differentiation.bioRxiv : the preprint server for biology. 2023 Aug 10; . PMID: 37790399
Middelhauve V, Siebrasse JP, Kubitscheck UExpansion Microscopy of Bacillus subtilis.Methods in molecular biology (Clifton, N.J.). 2023; 2601:191-202. PMID: 36445585
Dempwolff F, Kearns DBTnFLXopen: Markerless Transposons for Functional Fluorescent Fusion Proteins and Protein Interaction Prediction.Microbiology spectrum. 2022 May 2; :e0242821. PMID: 35499319
Giacomelli G, Feddersen H, Peng F, Martins GB, Grafemeyer M, Meyer F, Mayer B, Graumann PL, Bramkamp MSubcellular Dynamics of a Conserved Bacterial Polar Scaffold Protein.Genes. 2022 Jan 30; 13(2). PMID: 35205323
Feddersen H, Würthner L, Frey E, Bramkamp MDynamics of the Bacillus subtilis Min System.mBio. 2021 Apr 13; 12(2). PMID: 33849976
Sharma K, Sultana T, Dahms TES, Dillon JRCcpN: a moonlighting protein regulating catabolite repression of gluconeogenic genes in Bacillus subtilis also affects cell length and interacts with DivIVA.Canadian journal of microbiology. 2020 Aug 7; :1-10. PMID: 32762636
Jurásek M, Flärdh K, Vácha R Effect of membrane composition on DivIVA-membrane interaction. Biochimica et biophysica acta. Biomembranes. 2019 Dec 07; :183144. pii:S0005-2736(19)30292-5. doi:10.1016/j.bbamem.2019.183144. PMID:31821790
Ishikawa K, Matsuoka S, Hara H, Matsumoto K Septal membrane localization by C-terminal amphipathic α-helices of MinD in Bacillus subtilis mutant cells lacking MinJ or DivIVA. Genes & genetic systems. 2017 Jun 30; . doi:10.1266/ggs.16-00054. PMID:28674273
Kloosterman TG, Lenarcic R, Willis CR, Roberts DM, Hamoen LW, Errington J, Wu LJ Complex polar machinery required for proper chromosome segregation in vegetative and sporulating cells of Bacillus subtilis. Molecular microbiology. 2016 Jul; 101(2):333-50. doi:10.1111/mmi.13393. PMID:27059541
Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS biology. 2016 Jan; 14(1):e1002341. doi:10.1371/journal.pbio.1002341. PMID:26735940
Pompeo F, Foulquier E, Serrano B, Grangeasse C, Galinier A Phosphorylation of the cell division protein GpsB regulates PrkC kinase activity through a negative feedback loop in Bacillus subtilis. Molecular microbiology. 2015 Jul; 97(1):139-50. doi:10.1111/mmi.13015. PMID:25845974
Eswaramoorthy P, Winter PW, Wawrzusin P, York AG, Shroff H, Ramamurthi KS Asymmetric division and differential gene expression during a bacterial developmental program requires DivIVA. PLoS genetics. 2014 Aug; 10(8):e1004526. doi:10.1371/journal.pgen.1004526. PMID:25101664
Bach JN, Albrecht N, Bramkamp M Imaging DivIVA dynamics using photo-convertible and activatable fluorophores in Bacillus subtilis. Frontiers in microbiology. 2014; 5:59. doi:10.3389/fmicb.2014.00059. PMID:24600441
Halbedel S, Kawai M, Breitling R, Hamoen LW SecA is required for membrane targeting of the cell division protein DivIVA in vivo. Frontiers in microbiology. 2014; 5:58. doi:10.3389/fmicb.2014.00058. PMID:24592260
Renner LD, Eswaramoorthy P, Ramamurthi KS, Weibel DB Studying biomolecule localization by engineering bacterial cell wall curvature. PloS one. 2013; 8(12):e84143. doi:10.1371/journal.pone.0084143. PMID:24391905
Vishnoi M, Narula J, Devi SN, Dao HA, Igoshin OA, Fujita M Triggering sporulation in Bacillus subtilis with artificial two-component systems reveals the importance of proper Spo0A activation dynamics. Molecular microbiology. 2013 Oct; 90(1):181-94. doi:10.1111/mmi.12357. PMID:23927765
Trip EN, Veening JW, Stewart EJ, Errington J, Scheffers DJ Balanced transcription of cell division genes in Bacillus subtilis as revealed by single cell analysis. Environmental microbiology. 2013 Dec; 15(12):3196-209. doi:10.1111/1462-2920.12148. PMID:23701187
van Baarle S, Celik IN, Kaval KG, Bramkamp M, Hamoen LW, Halbedel S Protein-protein interaction domains of Bacillus subtilis DivIVA. Journal of bacteriology. 2013 Mar; 195(5):1012-21. doi:10.1128/JB.02171-12. PMID:23264578
Pogliano J, Pogliano N, Silverman JA Daptomycin-mediated reorganization of membrane architecture causes mislocalization of essential cell division proteins. Journal of bacteriology. 2012 Sep; 194(17):4494-504. doi:10.1128/JB.00011-12. PMID:22661688
dos Santos VT, Bisson-Filho AW, Gueiros-Filho FJ DivIVA-mediated polar localization of ComN, a posttranscriptional regulator of Bacillus subtilis. Journal of bacteriology. 2012 Jul; 194(14):3661-9. doi:10.1128/JB.05879-11. PMID:22582279
Elsholz AK, Turgay K, Michalik S, Hessling B, Gronau K, Oertel D, Mäder U, Bernhardt J, Becher D, Hecker M, Gerth U Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2012 May 08; 109(19):7451-6. doi:10.1073/pnas.1117483109. PMID:22517742
Rodrigues CD, Harry EJ The Min system and nucleoid occlusion are not required for identifying the division site in Bacillus subtilis but ensure its efficient utilization. PLoS genetics. 2012; 8(3):e1002561. doi:10.1371/journal.pgen.1002561. PMID:22457634
Eswaramoorthy P, Erb ML, Gregory JA, Silverman J, Pogliano K, Pogliano J, Ramamurthi KS Cellular architecture mediates DivIVA ultrastructure and regulates min activity in Bacillus subtilis. mBio. 2011; 2(6). doi:10.1128/mBio.00257-11. pii:e00257-11. PMID:22108385
Briley K, Prepiak P, Dias MJ, Hahn J, Dubnau D Maf acts downstream of ComGA to arrest cell division in competent cells of B. subtilis. Molecular microbiology. 2011 Jul; 81(1):23-39. doi:10.1111/j.1365-2958.2011.07695.x. PMID:21564336
Oliva MA, Halbedel S, Freund SM, Dutow P, Leonard TA, Veprintsev DB, Hamoen LW, Löwe J Features critical for membrane binding revealed by DivIVA crystal structure. The EMBO journal. 2010 Jun 16; 29(12):1988-2001. doi:10.1038/emboj.2010.99. PMID:20502438
van Baarle S, Bramkamp M The MinCDJ system in Bacillus subtilis prevents minicell formation by promoting divisome disassembly. PloS one. 2010 Mar 24; 5(3):e9850. doi:10.1371/journal.pone.0009850. PMID:20352045
Ramamurthi KS, Losick R Negative membrane curvature as a cue for subcellular localization of a bacterial protein. Proceedings of the National Academy of Sciences of the United States of America. 2009 Aug 11; 106(32):13541-5. doi:10.1073/pnas.0906851106. PMID:19666580
Juarez JR, Margolin W Irresistible curves. The EMBO journal. 2009 Aug 05; 28(15):2147-8. doi:10.1038/emboj.2009.167. PMID:19654604
Lenarcic R, Halbedel S, Visser L, Shaw M, Wu LJ, Errington J, Marenduzzo D, Hamoen LW Localisation of DivIVA by targeting to negatively curved membranes. The EMBO journal. 2009 Aug 05; 28(15):2272-82. doi:10.1038/emboj.2009.129. PMID:19478798
Gamba P, Veening JW, Saunders NJ, Hamoen LW, Daniel RA Two-step assembly dynamics of the Bacillus subtilis divisome. Journal of bacteriology. 2009 Jul; 191(13):4186-94. doi:10.1128/JB.01758-08. PMID:19429628
Bramkamp M, Emmins R, Weston L, Donovan C, Daniel RA, Errington J A novel component of the division-site selection system of Bacillus subtilis and a new mode of action for the division inhibitor MinCD. Molecular microbiology. 2008 Dec; 70(6):1556-69. doi:10.1111/j.1365-2958.2008.06501.x. PMID:19019154
Perry SE, Edwards DH The Bacillus subtilis DivIVA protein has a sporulation-specific proximity to Spo0J. Journal of bacteriology. 2006 Aug; 188(16):6039-43. . PMID:16885474
Perry SE, Edwards DH Identification of a polar targeting determinant for Bacillus subtilis DivIVA. Molecular microbiology. 2004 Dec; 54(5):1237-49. . PMID:15554965
Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R The Spo0A regulon of Bacillus subtilis. Molecular microbiology. 2003 Dec; 50(5):1683-701. . PMID:14651647
Hamoen LW, Errington J Polar targeting of DivIVA in Bacillus subtilis is not directly dependent on FtsZ or PBP 2B. Journal of bacteriology. 2003 Jan; 185(2):693-7. . PMID:12511520
Gueiros-Filho FJ, Losick R A widely conserved bacterial cell division protein that promotes assembly of the tubulin-like protein FtsZ. Genes & development. 2002 Oct 01; 16(19):2544-56. . PMID:12368265
Karoui ME, Errington J Isolation and characterization of topological specificity mutants of minD in Bacillus subtilis. Molecular microbiology. 2001 Dec; 42(5):1211-21. . PMID:11886553
Thomaides HB, Freeman M, El Karoui M, Errington J Division site selection protein DivIVA of Bacillus subtilis has a second distinct function in chromosome segregation during sporulation. Genes & development. 2001 Jul 01; 15(13):1662-73. . PMID:11445541
Thomaides HB, Freeman M, El Karoui M, Errington J Division site selection protein DivIVA of Bacillus subtilis has a second distinct function in chromosome segregation during sporulation. Genes & development. 2001 Jul 01; 15(13):1662-73. . PMID:11445541
Edwards DH, Thomaides HB, Errington J Promiscuous targeting of Bacillus subtilis cell division protein DivIVA to division sites in Escherichia coli and fission yeast. The EMBO journal. 2000 Jun 01; 19(11):2719-27. . PMID:10835369
Edwards DH, Errington J The Bacillus subtilis DivIVA protein targets to the division septum and controls the site specificity of cell division. Molecular microbiology. 1997 Jun; 24(5):905-15. . PMID:9219999
Edwards DH, Errington J The Bacillus subtilis DivIVA protein targets to the division septum and controls the site specificity of cell division. Molecular microbiology. 1997 Jun; 24(5):905-15. . PMID:9219999
Cha JH, Stewart GC The divIVA minicell locus of Bacillus subtilis. Journal of bacteriology. 1997 Mar; 179(5):1671-83. . PMID:9045828