pbpG

168

forespore-specific class A penicillin-binding protein 2d, required for stabilization of septal pore during engulfment, germ cell wall synthesis (functionally redundant with PbpF)

Locus: BSU_37510

Molecular weight: 71.66 kDa

Isoelectric point: 9.39

Protein length: 691 aa

Gene length: 2076 bp

Function: bifunctional glucosyltransferase/ transpeptidase, synthesis of spore peptidoglycan, stabilization of septal pore during engulfment

Product: forespore-specific penicillin-binding protein 2d

Essential: no

Synonyms: pbpG, ywhE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0744 (Galperin et al., 2021)

Gene

Coordinates: 3,849,818 → 3,851,893

Phenotypes of a mutant

• a strain lacking all four class A penicillin-binding proteins (ponA pbpD pbpF pbpG) is severely inhibited for L-form switching in the presence of D-cycloserine PubMed
• a pbpG pbpF double mutant results in abberant deposition of the spore cortex PubMed
• a pbpG spoIIIM double mutant has a reduced sporulation efficiency (8.8%) PubMed
• a pbpG spoIIIM double mutant exhibits a severe miscompartmentalization defect PubMed
• a pbpG spoIIIM double mutant exhibits severe spore morphological defects PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of spore peptidoglycan (with PbpF) PubMed
• [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol --> [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H⁺ (according to UniProt)
• Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)

Protein family

• N-terminal part: glycosyltransferase 51 family (according to UniProt)
• C-terminal part: transpeptidase family (according to UniProt)

Structure

• 3VMA (PDB) (PBP1B from E. coli, 29% identity) PubMed
• P70997 (AlphaFold)

Paralogous protein(s)

• PbpD, PbpF, PonA

Localization

• cell membrane, the major part of the protein is exposed to the outside (according to UniProt)
• forespore Link to a summary

Expression and Regulation

Operons

• Genes: pbpG

  Description: PubMed

  Regulation

  • expressed during sporulation in the forespore (SigF, SigG) PubMed

  Sigma factors

  • SigG: sigma factor, PubMed, in sigG regulon
  • SigF: sigma factor, in sigF regulon

  Additional information

  • A ncRNA is predicted between 'pbpG' and 'ywhD' PubMed

Biological materials

Mutant

• MGNA-A520 (ywhE::erm), available at the NBRP B. subtilis, Japan
• BKE37510 (ΔpbpG::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAACGGGTTCCCCCTTTT,  downstream forward: _UP4_TGAAAATAACCCGGCTCCTC
• BKK37510 (ΔpbpG::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAACGGGTTCCCCCTTTT,  downstream forward: _UP4_TGAAAATAACCCGGCTCCTC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jeff Errington lab

GFP fusion

• 3510 trpC2 pbpG::pSG5309 (cat P_xyl-gfpa-pbpG1-544) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC

References

Reviews

Loading

Original Publications

Loading