spsA

168

nucleotide-sugar-dependent glycosyltransferase

Locus: BSU_37910

Molecular weight: 30.03 kDa

Isoelectric point: 5.36

Protein length: 256 aa

Gene length: 771 bp

Function: spore crust polysaccharide synthesis

Product: nucleotide-sugar-dependent glycosyltransferase

Essential: no

Synonyms: spsA, ipa-63d

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

List of homologs in different organisms, belongs to COG0463 (Galperin et al., 2021)

This gene is a member of the following regulons

SigE regulon, GerE regulon, SigK regulon

Gene

Coordinates: 3,892,351  3,893,121

Phenotypes of a mutant

the mutant tends to acquire suppressor mutations that result in improved growth PubMed
reduced germination efficiency PubMed
less hydrophobic spore surface PubMed

The protein

Protein family

glycosyltransferase 2 family PubMed

Structure

1QGS (PDB) (complex with UDP) PubMed
1H7Q (PDB)\tPubMed
P39621 (AlphaFold)

Paralogous protein(s)

CgeD, Array

Expression and Regulation

Operons

Genes: spsA-spsB-spsC-spsD-spsE-spsF-spsG-spsI-spsJ-spsK-spsL

Description: PubMed

Regulation

expressed during sporulation in the mother cell (SigE, SigK, GerE) PubMed

Regulatory mechanism

GerE: activation, PubMed, in gerE regulon

Sigma factors

SigE: sigma factor, PubMed, in sigE regulon
SigK: sigma factor, PubMed, in sigK regulon

Additional information

the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

BKE37910 (spsA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAATCCTACACCTCCTTCT,  downstream forward: _UP4_AAAAAGCTTGGAATGGGGTG
BKK37910 (spsA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAATCCTACACCTCCTTCT,  downstream forward: _UP4_AAAAAGCTTGGAATGGGGTG

References

Loading