mutM

168

formamidopyrimidine-DNA glycosidase, part of the error prevention oxidized guanine system (with [protein|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY] and [protein|50A50E33796EEF8046142EE928753C355EF42A1A|rppH])

locus: BSU_29080

Molecular weight: 31.06 kDa

pI: 8.89

Protein length: 276 aa

Gene length: 831 bp

function: DNA repair

product: formamidopyrimidine-DNA glycosidase

essential: no

ec: 3.2.2.23

synonyms: mutM, ytaE

List of homologs in different organisms, belongs to COG0266 (Galperin et al., 2021)

Gene

Coordinates: 2,972,329 → 2,973,159

Phenotypes of a mutant

• increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage [Pubmed|24973075]
• absence of MutM promotes mutagenesis allowing nutritionally stressed ''B. subtilis'' cells to escape from growth limiting conditions [Pubmed|25825434]
• increased sponteous mutation rate [Pubmed|25825434]

The protein

Catalyzed reaction/ biological activity

• binds to abasic and RNA base DNA lesions [pubmed|37250769]
• Hydrolysis of DNA containing ring-opened 7-methylguanine residues, releasing 2,6-diamino-4-hydroxy-5-(N-methyl)formamidopyrimidine (according to UniProt)
• The C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken by a beta-elimination reaction, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate (according to UniProt)

Protein family

• FPG family (single member, according to UniProt)

Structure

• [PDB|2F5S] (complex with oxoG:C, Geobacillus stearothermophilus)
• [AF|O34403]

[wiki|Localization]

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]-[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]-[gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]-[gene|E163A282560DB882B81E783E7E95E1960F4AE4D2|coaE]

  description: [pubmed|22383849]

  sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|23396918], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]

Biological materials

Mutant

• MGNA-A116 (mutM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/116 NBRP B. subtilis, Japan]
• BKE29080 (Δ[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATCCATCACTTCCTATC,  downstream forward: _UP4_TAGCATAATGCTTCATTGTC
• BKK29080 (Δ[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29080 BGSC] and in [wiki|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CACATCCATCACTTCCTATC,  downstream forward: _UP4_TAGCATAATGCTTCATTGTC

References

Reviews

• 22933559,35210609,38551349

Original Publications

• 19011023,19889642,24973075,25825434,33510358,37250769