mutM

168

formamidopyrimidine-DNA glycosidase, part of the error prevention oxidized guanine system (with MutY and RppH)

Locus: BSU_29080

Molecular weight: 31.06 kDa

Isoelectric point: 8.89

Protein length: 276 aa

Gene length: 831 bp

Function: DNA repair

Product: formamidopyrimidine-DNA glycosidase

Essential: no

E.C.: 3.2.2.23

Synonyms: mutM, ytaE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, DNA repair/ recombination

Information processing, Genetics, DNA repair/ recombination, Oxidized guanine (GO) DNA repair system

List of homologs in different organisms, belongs to COG0266 (Galperin et al., 2021)

This gene is a member of the following regulons

SigE regulon

Gene

Coordinates: 2,972,329 → 2,973,159

Phenotypes of a mutant

increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage PubMed
absence of MutM promotes mutagenesis allowing nutritionally stressed B. subtilis cells to escape from growth limiting conditions PubMed
increased sponteous mutation rate PubMed

The protein

Catalyzed reaction/ biological activity

binds to abasic and RNA base DNA lesions PubMed
Hydrolysis of DNA containing ring-opened 7-methylguanine residues, releasing 2,6-diamino-4-hydroxy-5-(N-methyl)formamidopyrimidine (according to UniProt)
The C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken by a beta-elimination reaction, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate (according to UniProt)

Protein family

FPG family (single member, according to UniProt)

Structure

2F5S (PDB) (complex with oxoG:C, Geobacillus stearothermophilus)
O34403 (AlphaFold)

Localization

cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: polA-mutM-ytaF-coaE

Description: PubMed

Sigma factors

SigE: sigma factor, PubMed, in sigE regulon

Biological materials

Mutant

MGNA-A116 (mutM::erm), available at the NBRP B. subtilis, Japan
BKE29080 (ΔmutM::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATCCATCACTTCCTATC,  downstream forward: _UP4_TAGCATAATGCTTCATTGTC
BKK29080 (ΔmutM::kan  trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CACATCCATCACTTCCTATC,  downstream forward: _UP4_TAGCATAATGCTTCATTGTC

References

Reviews

Pedraza-Reyes M, Abundiz-Yañez K, Rangel-Mendoza A, Martínez LE, Barajas-Ornelas RC, Cuéllar-Cruz M, Leyva-Sánchez HC, Ayala-García VM, Valenzuela-García LI, Robleto EABacillus subtilis stress-associated mutagenesis and developmental DNA repair.Microbiology and molecular biology reviews : MMBR. 2024 Mar 29; :e0015823. PMID: 38551349
Wozniak KJ, Simmons LABacterial DNA excision repair pathways.Nature reviews. Microbiology. 2022 Aug; 20(8):465-477. PMID: 35210609
Lenhart JS, Schroeder JW, Walsh BW, Simmons LA DNA repair and genome maintenance in Bacillus subtilis. Microbiology and molecular biology reviews : MMBR. 2012 Sep; 76(3):530-64. doi:10.1128/MMBR.05020-11. PMID:22933559

Original Publications

Nischwitz E, Schoonenberg VAC, Fradera-Sola A, Dejung M, Vydzhak O, Levin M, Luke B, Butter F, Scheibe MDNA damage repair proteins across the Tree of Life.iScience. 2023 Jun 16; 26(6):106778. PMID: 37250769
Suárez VP, Martínez LE, Leyva-Sánchez HC, Valenzuela-García LI, Lara-Martínez R, Jiménez-García LF, Ramírez-Ramírez N, Obregon-Herrera A, Cuéllar-Cruz M, Robleto EA, Pedraza-Reyes MTranscriptional coupling and repair of 8-OxoG activate a RecA-dependent checkpoint that controls the onset of sporulation in Bacillus subtilis.Scientific reports. 2021 Jan 28; 11(1):2513. PMID: 33510358
Gómez-Marroquín M, Vidales LE, Debora BN, Santos-Escobar F, Obregón-Herrera A, Robleto EA, Pedraza-Reyes M Role of Bacillus subtilis DNA Glycosylase MutM in Counteracting Oxidatively Induced DNA Damage and in Stationary-Phase-Associated Mutagenesis. Journal of bacteriology. 2015 Jun; 197(11):1963-71. doi:10.1128/JB.00147-15. PMID:25825434
Santos-Escobar F, Gutiérrez-Corona JF, Pedraza-Reyes M Role of Bacillus subtilis error prevention oxidized guanine system in counteracting hexavalent chromium-promoted oxidative DNA damage. Applied and environmental microbiology. 2014 Sep; 80(17):5493-502. doi:10.1128/AEM.01665-14. PMID:24973075
Qi Y, Spong MC, Nam K, Karplus M, Verdine GL Entrapment and structure of an extrahelical guanine attempting to enter the active site of a bacterial DNA glycosylase, MutM. The Journal of biological chemistry. 2010 Jan 08; 285(2):1468-78. doi:10.1074/jbc.M109.069799. PMID:19889642
Vidales LE, Cárdenas LC, Robleto E, Yasbin RE, Pedraza-Reyes M Defects in the error prevention oxidized guanine system potentiate stationary-phase mutagenesis in Bacillus subtilis. Journal of bacteriology. 2009 Jan; 191(2):506-13. doi:10.1128/JB.01210-08. PMID:19011023