minC

168

cell-division inhibitor (septum placement), destabilizes Z ring placement

Locus: BSU_28000

Molecular weight: 24.85 kDa

Isoelectric point: 6.26

Protein length: 226 aa

Gene length: 681 bp

Function: septum placement

Product: cell-division inhibitor

Essential: no

Synonyms: minC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0850 (Galperin et al., 2021)

Gene

Coordinates: 2,858,584  2,859,264

Phenotypes of a mutant

• a ''whiA minC-minD'' mutant grows poorly, and the cells are filamentous PubMed

The protein

Catalyzed reaction/ biological activity

• The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle  PubMed
• binds the C-terminal domain of FtsZ to inhibit its polymerization PubMed

Protein family

• minC family (single member, according to UniProt)

Structure

• 4M4I (PDB) (N-terminal domain, aa 4 ... 105) PubMed
• 1HF2 (PDB) (from Thermotoga maritima, 26% identity) PubMed
• Q01463 (AlphaFold)

Localization

• polar/septal at the cell membrane PubMed
• membrane binding/polar localization depends on the proton motive force PubMed

Expression and Regulation

Operons

• Genes: mreB-mreC-mreD-minC-minD

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

  Regulatory mechanism

  • ComK: activation, PubMed, in comK regulon

  Sigma factors

  • SigA: sigma factor, promoter p1, upstream of Maf PubMed, in sigA regulon
  • SigM: sigma factor, promoter p2, within Maf PubMed, in sigM regulon
  • SigH: sigma factor, promoter p4, upstream of MinC PubMed, in sigH regulon

• Genes: minC-minD

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

• Genes: maf-radC-mreB-mreC-mreD-minC-minD

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

  Regulatory mechanism

  • ComK: activation, PubMed, in comK regulon

  Sigma factors

  • SigM: sigma factor, promoter p2 within Maf PubMed, in sigM regulon
  • SigA: sigma factor, promoter p1, upstream of Maf PubMed, in sigA regulon

Biological materials

Mutant

• BSN375 (''minC::aphA3'') (available in Leendert Hamoen's, Sven Halbedel's and Jörg Stülke's labs)
• BKE28000 (minC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAATATTCACCTCAACAA,  downstream forward: _UP4_ACAAGGCTTGAGGGAGGAAT
• BKK28000 (minC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAATATTCACCTCAACAA,  downstream forward: _UP4_ACAAGGCTTGAGGGAGGAAT

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading