sasA

168

(p)ppGpp synthetase, small alarmone synthetase, contributes to cellular heterogeneity in protein synthesis during nutrient limitation

Locus: BSU_38480

Molecular weight: 24.45 kDa

Isoelectric point: 6.22

Protein length: 210 aa

Gene length: 633 bp

Function: ppGpp synthesis independent from stringent response

Product: (p)ppGpp synthetase

Essential: no

Synonyms: sasA, ywaC, relP, ipa-7d

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2357 (Galperin et al., 2021)

Gene

Coordinates: 3,949,952  3,950,584

Phenotypes of a mutant

• a rel sasA sasB triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of guaA or inactivation of codY PubMed
• a rel sasA sasB triple mutant acquires suppressor mutations in guaA, guaA, gmk or inactivation of codY PubMed
• a rel sasA sasB triple mutant is unable to grow in the presence of guanosine, this can be suppressed by inactivation of pyk, hprT, or gmk PubMed

The protein

Catalyzed reaction/ biological activity

• ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)

Protein family

• RelA/SpoT family (with SasB and Rel, according to UniProt)

Domains

• single ppGpp synthetase domain PubMed

Structure

• 6FGK (PDB) PubMed
• P39583 (AlphaFold)

Paralogous protein(s)

• SasB

Expression and Regulation

Operons

• Genes: sasA

  Description: PubMed

  Regulation

  • expression is reduced in a SigV mutant PubMed

  Regulatory mechanism

  • WalR: repression, PubMed, in walR regulon

  Sigma factors

  • SigM: sigma factor, PubMed, in sigM regulon
  • SigW: sigma factor, in sigW regulon
  • SigV: sigma factor, in sigV regulon

Biological materials

Mutant

• GP3470 (ΔsasA::spec ΔsasB::phleo), available in Jörg Stülke's lab
• GP3471 (ΔsasA::spec Δrel::cat), available in Jörg Stülke's lab
• GP3424 (ΔsasA::spec), available in Jörg Stülke's lab
• MGNA-B218 (ywaC::erm), available at the NBRP B. subtilis, Japan
• GP2066 (''sasA sasB rel::mls''), available in Jörg Stülke's lab
• BKE38480 (sasA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA,  downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
• BKK38480 (sasA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA,  downstream forward: _UP4_TAAAAAAGACGGCACCCAAG

Expression vectors

• pGP3451 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in Jörg Stülke's lab
• pGP3456: expression of Strep-rel by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3457: expression of rel-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

LacZ fusion

• GP3692 (based on pAC7), available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading