zur
168
transcriptional repressor, regulates zinc homeostasis
locus
BSU_25100
Molecular weight
16.42 kDa
pI
4.86
function
regulation of zinc homeostasis([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA], [gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB])
product
transcriptional repressor ([wiki|Fur family])
essential
no
synonyms
zur, yqfV
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0735 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,591,428 2,591,865
The protein
Protein family
[wiki|Fur family] (according to UniProt)
Structure
[PDB|2FE3] ([protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR], 35% identity) [pubmed|16925555]
[AF|P54479]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
Effectors of protein activity
sequential binding of zinc (two atoms per monomer) results in the activation of Zur dimer and thus in repression of the genes of the [wiki|Zur regulon] [Pubmed|21821657]
zinc binding is negatively co-operative resulting in step-wise induction of the genes of the [wiki|Zur regulon] upon zinc depletion [Pubmed|27561249]
Paralogous protein(s)
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur], [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]
[wiki|Localization]
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000090 PRODORIC2 database]
Expression and Regulation
Operons
genes
[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]-[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]
description
[Pubmed|22383849]
Biological materials
Mutant
1A904 ( ''zur''::''spec''), [Pubmed|12029044], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A904&Search=1A904 BGSC]
BKE25100 ([gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
BKK25100 ([gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
Reviews
Original Publications
Page visits: 7976
Time of last update: 2025-10-25 06:06:00
Author of last update: Jstuelk