sigB

168

RNA polymerase sigma factor SigB

Locus: BSU_04730

Molecular weight: 29.99 kDa

Isoelectric point: 5.42

Protein length: 262 aa

Gene length: 789 bp

Function: general stress response, biocontrol of fungal growth

Product: RNA polymerase sigma factor SigB

Essential: no

Synonyms: sigB, rpoF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5812 (Galperin et al., 2021)

Gene

Coordinates: 522,862  523,650

The protein

Protein family

• Sigma-70 factor family (according to UniProt)

Structure

• 1L0O (PDB) (SigF-SpoIIAB complex from Geobacillus stearothermophilus, 32% identity) PubMed
• P06574 (AlphaFold)

Effectors of protein activity

• SigB is activated during bacterial-fungal interaction (via RsbP) PubMed

Expression and Regulation

Operons

• Genes: rsbR-rsbS-rsbT-rsbU-rsbV-rsbW-sigB-rsbX

  Description: PubMed

  Regulation

  • ''rsbV:'' induced by stress (SigB) PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in ccpA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed, in sigB regulon

• Genes: rsbV-rsbW-sigB-rsbX

  Description: PubMed

  Regulation

  • ''rsbV:'' induced by stress (SigB) PubMed

Biological materials

Mutant

• QB5344 (cat), available in Jörg Stülke's lab
• 1A675 ( sigB::cat), PubMed, available at BGSC
• 1A777 ( sigB::cat), PubMed, available at BGSC
• 1A780 ( sigB::spec), PubMed, available at BGSC
• BKE04730 (sigB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GCTTATGAGCCGATCGACTT,  downstream forward: _UP4_GATCCCTCGATGGAGTTAAT
• BKK04730 (sigB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GCTTATGAGCCGATCGACTT,  downstream forward: _UP4_GATCCCTCGATGGAGTTAAT

Labs working on this gene/protein

• Bill Haldenwang, San Antonio, USA
• Chet Price, Davis, USA homepage

References

Reviews

Driller K, Cornejo FA, Turgay K(p)ppGpp - an important player during heat shock response.microLife. 2023; 4:uqad017. PMID: 37251512
Tran HT, Bonilla CYSigB-regulated antioxidant functions in gram-positive bacteria.World journal of microbiology & biotechnology. 2021 Feb 5; 37(3):38. PMID: 33544236
Rodriguez Ayala F, Bartolini M, Grau RThe Stress-Responsive Alternative Sigma Factor SigB of Bacillus subtilis and Its Relatives: An Old Friend With New Functions.Frontiers in microbiology. 2020; 11:1761. PMID: 33042030
Pané-Farré J, Quin MB, Lewis RJ, Marles-Wright J Structure and Function of the Stressosome Signalling Hub. Sub-cellular biochemistry. 2017; 83:1-41. doi:10.1007/978-3-319-46503-6_1. PMID:28271471
Schumann W Regulation of bacterial heat shock stimulons. Cell stress & chaperones. 2016 Nov; 21(6):959-968. . PMID:27518094
Marles-Wright J, Lewis RJ The stressosome: molecular architecture of a signalling hub. Biochemical Society transactions. 2010 Aug; 38(4):928-33. doi:10.1042/BST0380928. PMID:20658979
Zuber P Management of oxidative stress in Bacillus. Annual review of microbiology. 2009; 63:575-97. doi:10.1146/annurev.micro.091208.073241. PMID:19575568
Hecker M, Pané-Farré J, Völker U SigB-dependent general stress response in Bacillus subtilis and related gram-positive bacteria. Annual review of microbiology. 2007; 61:215-36. . PMID:18035607
Hecker M, Völker U General stress response of Bacillus subtilis and other bacteria. Advances in microbial physiology. 2001; 44:35-91. . PMID:11407115
Hecker M, Völker U Non-specific, general and multiple stress resistance of growth-restricted Bacillus subtilis cells by the expression of the sigmaB regulon. Molecular microbiology. 1998 Sep; 29(5):1129-36. . PMID:9767581

Other publications

Loading

Identification of the SigB regulon

Loading

Control of SigB activity by protein-protein interactions

Loading