sigB

168

RNA polymerase sigma factor SigB

Locus: BSU_04730

Molecular weight: 29.99 kDa

Isoelectric point: 5.42

Protein length: 262 aa

Gene length: 789 bp

Function: general stress response, biocontrol of fungal growth

Product: RNA polymerase sigma factor SigB

Essential: no

Synonyms: sigB, rpoF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5812 (Galperin et al., 2021)

Gene

Coordinates: 522,862  523,650

The protein

Protein family

• Sigma-70 factor family (according to UniProt)

Structure

• 1L0O (PDB) (SigF-SpoIIAB complex from Geobacillus stearothermophilus, 32% identity) PubMed
• P06574 (AlphaFold)

Effectors of protein activity

• SigB is activated during bacterial-fungal interaction (via RsbP) PubMed

Expression and Regulation

Operons

• Genes: rsbR-rsbS-rsbT-rsbU-rsbV-rsbW-sigB-rsbX

  Description: PubMed

  Regulation

  • ''rsbV:'' induced by stress (SigB) PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in ccpA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed, in sigB regulon

• Genes: rsbV-rsbW-sigB-rsbX

  Description: PubMed

  Regulation

  • ''rsbV:'' induced by stress (SigB) PubMed

Biological materials

Mutant

• QB5344 (cat), available in Jörg Stülke's lab
• 1A675 ( sigB::cat), PubMed, available at BGSC
• 1A777 ( sigB::cat), PubMed, available at BGSC
• 1A780 ( sigB::spec), PubMed, available at BGSC
• BKE04730 (sigB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GCTTATGAGCCGATCGACTT,  downstream forward: _UP4_GATCCCTCGATGGAGTTAAT
• BKK04730 (sigB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GCTTATGAGCCGATCGACTT,  downstream forward: _UP4_GATCCCTCGATGGAGTTAAT

Labs working on this gene/protein

• Bill Haldenwang, San Antonio, USA
• Chet Price, Davis, USA homepage

References

Reviews

Driller K, Cornejo FA, Turgay K(p)ppGpp - an important player during heat shock response.microLife. 2023; 4:uqad017. PMID: 37251512
Tran HT, Bonilla CYSigB-regulated antioxidant functions in gram-positive bacteria.World journal of microbiology & biotechnology. 2021 Feb 5; 37(3):38. PMID: 33544236
Rodriguez Ayala F, Bartolini M, Grau RThe Stress-Responsive Alternative Sigma Factor SigB of Bacillus subtilis and Its Relatives: An Old Friend With New Functions.Frontiers in microbiology. 2020; 11:1761. PMID: 33042030
Pané-Farré J, Quin MB, Lewis RJ, Marles-Wright J Structure and Function of the Stressosome Signalling Hub. Sub-cellular biochemistry. 2017; 83:1-41. doi:10.1007/978-3-319-46503-6_1. PMID:28271471
Schumann W Regulation of bacterial heat shock stimulons. Cell stress & chaperones. 2016 Nov; 21(6):959-968. . PMID:27518094
Marles-Wright J, Lewis RJ The stressosome: molecular architecture of a signalling hub. Biochemical Society transactions. 2010 Aug; 38(4):928-33. doi:10.1042/BST0380928. PMID:20658979
Zuber P Management of oxidative stress in Bacillus. Annual review of microbiology. 2009; 63:575-97. doi:10.1146/annurev.micro.091208.073241. PMID:19575568
Hecker M, Pané-Farré J, Völker U SigB-dependent general stress response in Bacillus subtilis and related gram-positive bacteria. Annual review of microbiology. 2007; 61:215-36. . PMID:18035607
Hecker M, Völker U General stress response of Bacillus subtilis and other bacteria. Advances in microbial physiology. 2001; 44:35-91. . PMID:11407115
Hecker M, Völker U Non-specific, general and multiple stress resistance of growth-restricted Bacillus subtilis cells by the expression of the sigmaB regulon. Molecular microbiology. 1998 Sep; 29(5):1129-36. . PMID:9767581

Other publications

Loading

Identification of the SigB regulon

Yeak KYC, Boekhorst J, Wels M, Abee T, Wells-Bennik MHJPrediction and validation of novel SigB regulon members in Bacillus subtilis and regulon structure comparison to Bacillales members.BMC microbiology. 2023 Jan 18; 23(1):17. PMID: 36653740
Vohradsky J, Schwarz M, Ramaniuk O, Ruiz-Larrabeiti O, Vaňková Hausnerová V, Šanderová H, Krásný LKinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth.Microorganisms. 2021 Jan 5; 9(1). PMID: 33466511
Nannapaneni P, Hertwig F, Depke M, Hecker M, Mäder U, Völker U, Steil L, van Hijum SA Defining the structure of the general stress regulon of Bacillus subtilis using targeted microarray analysis and random forest classification. Microbiology (Reading, England). 2012 Mar; 158(Pt 3):696-707. doi:10.1099/mic.0.055434-0. PMID:22174379
Helmann JD, Wu MF, Kobel PA, Gamo FJ, Wilson M, Morshedi MM, Navre M, Paddon C Global transcriptional response of Bacillus subtilis to heat shock. Journal of bacteriology. 2001 Dec; 183(24):7318-28. . PMID:11717291
Petersohn A, Brigulla M, Haas S, Hoheisel JD, Völker U, Hecker M Global analysis of the general stress response of Bacillus subtilis. Journal of bacteriology. 2001 Oct; 183(19):5617-31. . PMID:11544224
Price CW, Fawcett P, Cérémonie H, Su N, Murphy CK, Youngman P Genome-wide analysis of the general stress response in Bacillus subtilis. Molecular microbiology. 2001 Aug; 41(4):757-74. . PMID:11532142
Petersohn A, Bernhardt J, Gerth U, Höper D, Koburger T, Völker U, Hecker M Identification of sigma(B)-dependent genes in Bacillus subtilis using a promoter consensus-directed search and oligonucleotide hybridization. Journal of bacteriology. 1999 Sep; 181(18):5718-24. . PMID:10482513
Petersohn A, Antelmann H, Gerth U, Hecker M Identification and transcriptional analysis of new members of the sigmaB regulon in Bacillus subtilis. Microbiology (Reading, England). 1999 Apr; 145 ( Pt 4):869-80. . PMID:10220166

Control of SigB activity by protein-protein interactions

Loading