braB

168

branched-chain amino acid transporter

Locus: BSU_29600

Molecular weight: 46.45 kDa

Isoelectric point: 9.65

Protein length: 445 aa

Gene length: 1338 bp

Function: uptake of branched-chain amino acids

Product: branched-chain amino acid transporter

Essential: no

Synonyms: braB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1114 (Galperin et al., 2021)

Gene

Coordinates: 3,028,297  3,029,634

Phenotypes of a mutant

• no phenotype for the single mutant, the triple ''bcaP brnQ braB'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations PubMed

The protein

Catalyzed reaction/ biological activity

• high affinity uptake of isoleucine and valine PubMed

Protein family

• branched chain amino acid transporter family (together with BrnQ) (according to UniProt)

Structure

• O34545 (AlphaFold)

Paralogous protein(s)

• BrnQ

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: braB

  Description: PubMed

  Regulation

  • induced in the absence of branched-chain amino acids (CodY, ScoC) PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon
  • ScoC: repression, PubMed, in scoC regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • note that CodY represses the expression of ''scoC, therefore braB'' expression is increased at intermediate levels of CodY activity PubMed

Biological materials

Mutant

• GP4152 (ΔbraB::aphA3), available in Jörg Stülke's lab
• GP4157 (ΔbraB::aphA3, ΔbcaP::ermC), available in Jörg Stülke's lab
• BKE29600 (braB::erm trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA,  downstream forward: _UP4_TAATGTCACAGAACGCCTGC
• BKK29600 (braB::kan trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA,  downstream forward: _UP4_TAATGTCACAGAACGCCTGC

References

Loading