aprE

168

major extracellular alkaline protease

Locus: BSU_10300

Molecular weight: 39.37 kDa

Isoelectric point: 9.34

Protein length: 381 aa

Gene length: 1146 bp

Function: protein degradation

Product: extracellular alkaline serine protease (subtilisin E)

Essential: no

Synonyms: aprE, sprE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1404 (Galperin et al., 2021)

Gene

Coordinates: 1,104,423  1,105,568

Phenotypes of a mutant

• impaired biofilm architecture PubMed

The protein

Catalyzed reaction/ biological activity

• Hydrolysis of proteins with broad specificity for peptide bonds, and a preference for a large uncharged residue in P1. Hydrolyzes peptide amides(according to UniProt)

Protein family

• peptidase S8 family (according to UniProt)

Domains

• Inhibitor I9 domain (aa 38-109) (according to UniProt)
• Peptidase S8 domain (aa 111-380) (according to UniProt)

Structure

• 1SBC (PDB)
• P04189 (AlphaFold)

Localization

• secreted (according to Swiss-Prot),  extracellular (signal peptide) PubMed

Expression and Regulation

Operons

• Genes: aprE

  Description: PubMed

  Regulation

  • repressed by SinR PubMed
  • induced in the presence of external ComX PubMed

  Regulatory mechanism

  • SinR: repression, PubMed, in sinR regulon
  • ScoC: repression, PubMed, in scoC regulon
  • AbrB: repression, PubMed, in abrB regulon
  • DegU: activation, DegU-P, PubMed, in degU regulon
  • CodY: repression, PubMed, in codY regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • in a triple ''abrB codY scoC'' mutant, expression occurs during exponential growth PubMed

Additional information

• expression is increased in a hag mutant due to the presence of increased levels of DegU-P PubMed
• the mRNA is very stable (> 15 min) PubMed

Biological materials

Mutant

• KO7 (nprE  aprE  epr  mpr  nprB  vpr  bpr), available as BGSC 1A1133
• BKE10300 (aprE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT,  downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
• BKK10300 (aprE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT,  downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG

Antibody

• **

References

Reviews

Azrin NAM, Ali MSM, Rahman RNZRA, Oslan SN, Noor NDMVersatility of subtilisin: A review on structure, characteristics and applications.Biotechnology and applied biochemistry. 2022 Jan 12; . PMID: 35019178
Harwood CR, Kikuchi YThe ins and outs of Bacillus proteases: activities, functions and commercial significance.FEMS microbiology reviews. 2021 Aug 19; . PMID: 34410368

Original Publications

Rosazza T, Earl C, Eigentler L, Davidson FA, Stanley-Wall NRReciprocal sharing of extracellular proteases and extracellular matrix molecules facilitates Bacillus subtilis biofilm formation.Molecular microbiology. 2024 Jun 22; . PMID: 38922753
Öktem A, Pranoto DA, van Dijl JMPost-translational secretion stress regulation in Bacillus subtilis is controlled by intra- and extracellular proteases.New biotechnology. 2023 Dec 27; 79:71-81. PMID: 38158017
Yannarell SM, Beaudoin ES, Talley HS, Schoenborn AA, Orr G, Anderton CR, Chrisler WB, Shank EAExtensive cellular multi-tasking within Bacillus subtilis biofilms.mSystems. 2023 Aug 1; :e0089122. PMID: 37527273
Spacapan M, Danevčič T, Mandic-Mulec I ComX-Induced Exoproteases Degrade ComX inPS-216. Frontiers in microbiology. 2018; 9:105. doi:10.3389/fmicb.2018.00105. PMID:29449835
Diethmaier C, Chawla R, Canzoneri A, Kearns DB, Lele PP, Dubnau D Viscous drag on the flagellum activates Bacillus subtilis entry into the K-state. Molecular microbiology. 2017 Nov; 106(3):367-380. doi:10.1111/mmi.13770. PMID:28800172
Barbieri G, Albertini AM, Ferrari E, Sonenshein AL, Belitsky BR Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis. Journal of bacteriology. 2016 Jan 04; 198(6):907-20. doi:10.1128/JB.00894-15. PMID:26728191
Jeong SJ, Heo K, Park JY, Lee KW, Park JY, Joo SH, Kim JH Characterization of AprE176, a fibrinolytic enzyme from Bacillus subtilis HK176. Journal of microbiology and biotechnology. 2015 Jan; 25(1):89-97. . PMID:25315053
Uehara R, Angkawidjaja C, Koga Y, Kanaya S Formation of the high-affinity calcium binding site in pro-subtilisin E with the insertion sequence IS1 of pro-Tk-subtilisin. Biochemistry. 2013 Dec 17; 52(50):9080-8. doi:10.1021/bi401342k. PMID:24279884
Pohl S, Bhavsar G, Hulme J, Bloor AE, Misirli G, Leckenby MW, Radford DS, Smith W, Wipat A, Williamson ED, Harwood CR, Cranenburgh RM Proteomic analysis of Bacillus subtilis strains engineered for improved production of heterologous proteins. Proteomics. 2013 Nov; 13(22):3298-308. doi:10.1002/pmic.201300183. PMID:24115457
Kada S, Ishikawa A, Ohshima Y, Yoshida K Alkaline serine protease AprE plays an essential role in poly-γ-glutamate production during natto fermentation. Bioscience, biotechnology, and biochemistry. 2013; 77(4):802-9. . PMID:23563567
Han X, Shiwa Y, Itoh M, Suzuki T, Yoshikawa H, Nakagawa T, Nagano H Molecular cloning and sequence analysis of an extracellular protease from four Bacillus subtilis strains. Bioscience, biotechnology, and biochemistry. 2013; 77(4):870-3. . PMID:23563549
Davidson FA, Seon-Yi C, Stanley-Wall NR Selective heterogeneity in exoprotease production by Bacillus subtilis. PloS one. 2012; 7(6):e38574. doi:10.1371/journal.pone.0038574. PMID:22745669
Gao W, Dai S, Liu Q, Xu H, Qiao M CitB mutation increases the alkaline protease productivity in Bacillus subtilis. The Journal of general and applied microbiology. 2010 Oct; 56(5):403-7. . PMID:21099137
Romero-García ER, Téllez-Valencia A, Trujillo MF, Sampedro JG, Nájera H, Rojo-Domínguez A, García-Soto J, Pedraza-Reyes M Engineering and directed evolution of a Ca2+ binding site A-deficient AprE mutant reveal an essential contribution of the loop Leu75-Leu82 to enzyme activity. Journal of biomedicine & biotechnology. 2009; 2009:201075. doi:10.1155/2009/201075. PMID:19710937
Abe S, Yasumura A, Tanaka T Regulation of Bacillus subtilis aprE expression by glnA through inhibition of scoC and sigma(D)-dependent degR expression. Journal of bacteriology. 2009 May; 191(9):3050-8. doi:10.1128/JB.00049-09. PMID:19251843
Voigt B, Antelmann H, Albrecht D, Ehrenreich A, Maurer KH, Evers S, Gottschalk G, van Dijl JM, Schweder T, Hecker M Cell physiology and protein secretion of Bacillus licheniformis compared to Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2009; 16(1-2):53-68. doi:10.1159/000142894. PMID:18957862
Veening JW, Igoshin OA, Eijlander RT, Nijland R, Hamoen LW, Kuipers OP Transient heterogeneity in extracellular protease production by Bacillus subtilis. Molecular systems biology. 2008; 4:184. doi:10.1038/msb.2008.18. PMID:18414485
Shimane K, Ogura M Mutational analysis of the helix-turn-helix region of Bacillus subtilis response regulator DegU, and identification of cis-acting sequences for DegU in the aprE and comK promoters. Journal of biochemistry. 2004 Sep; 136(3):387-97. . PMID:15598897
Ogura M, Matsuzawa A, Yoshikawa H, Tanaka T Bacillus subtilis SalA (YbaL) negatively regulates expression of scoC, which encodes the repressor for the alkaline exoprotease gene, aprE. Journal of bacteriology. 2004 May; 186(10):3056-64. . PMID:15126467
Arai A, Kawachi E, Hata M, Ogura M, Tanaka T Inhibition of Bacillus subtilis aprE expression by lincomycin at the posttranscriptional level through inhibition of ppGpp synthesis. Journal of biochemistry. 2003 Nov; 134(5):691-7. . PMID:14688235
Ogura M, Shimane K, Asai K, Ogasawara N, Tanaka T Binding of response regulator DegU to the aprE promoter is inhibited by RapG, which is counteracted by extracellular PhrG in Bacillus subtilis. Molecular microbiology. 2003 Sep; 49(6):1685-97. . PMID:12950930
Hambraeus G, von Wachenfeldt C, Hederstedt L Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs. Molecular genetics and genomics : MGG. 2003 Aug; 269(5):706-14. . PMID:12884008
Hambraeus G, Karhumaa K, Rutberg B A 5' stem-loop and ribosome binding but not translation are important for the stability of Bacillus subtilis aprE leader mRNA. Microbiology (Reading, England). 2002 Jun; 148(Pt 6):1795-803. . PMID:12055299
Urano T, Ihara H, Umemura K, Suzuki Y, Oike M, Akita S, Tsukamoto Y, Suzuki I, Takada A The profibrinolytic enzyme subtilisin NAT purified from Bacillus subtilis Cleaves and inactivates plasminogen activator inhibitor type 1. The Journal of biological chemistry. 2001 Jul 06; 276(27):24690-6. . PMID:11325965
Hambraeus G, Persson M, Rutberg B The aprE leader is a determinant of extreme mRNA stability in Bacillus subtilis. Microbiology (Reading, England). 2000 Dec; 146 Pt 12:3051-9. . PMID:11101663
Wong SL, Price CW, Goldfarb DS, Doi RH The subtilisin E gene of Bacillus subtilis is transcribed from a sigma 37 promoter in vivo. Proceedings of the National Academy of Sciences of the United States of America. 1984 Feb; 81(4):1184-8. . PMID:6322190
Perego M, Hoch JA Sequence analysis and regulation of the hpr locus, a regulatory gene for protease production and sporulation in Bacillus subtilis. Journal of bacteriology. 1988 Jun; 170(6):2560-7. . PMID:3131303
Ferrari E, Howard SM, Hoch JA Effect of stage 0 sporulation mutations on subtilisin expression. Journal of bacteriology. 1986 Apr; 166(1):173-9. . PMID:3082852
Strauch MA, Spiegelman GB, Perego M, Johnson WC, Burbulys D, Hoch JA The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein. The EMBO journal. 1989 May; 8(5):1615-21. . PMID:2504584
Henner DJ, Ferrari E, Perego M, Hoch JA Location of the targets of the hpr-97, sacU32(Hy), and sacQ36(Hy) mutations in upstream regions of the subtilisin promoter. Journal of bacteriology. 1988 Jan; 170(1):296-300. . PMID:2447063
Ferrari E, Henner DJ, Perego M, Hoch JA Transcription of Bacillus subtilis subtilisin and expression of subtilisin in sporulation mutants. Journal of bacteriology. 1988 Jan; 170(1):289-95. . PMID:2447062
Kallio PT, Fagelson JE, Hoch JA, Strauch MA The transition state regulator Hpr of Bacillus subtilis is a DNA-binding protein. The Journal of biological chemistry. 1991 Jul 15; 266(20):13411-7. . PMID:1906467
Kallio PT, Fagelson JE, Hoch JA, Strauch MA The transition state regulator Hpr of Bacillus subtilis is a DNA-binding protein. The Journal of biological chemistry. 1991 Jul 15; 266(20):13411-7. . PMID:1906467
Gaur NK, Oppenheim J, Smith I The Bacillus subtilis sin gene, a regulator of alternate developmental processes, codes for a DNA-binding protein. Journal of bacteriology. 1991 Jan; 173(2):678-86. . PMID:1898931