fabL

168

enoyl-acyl carrier protein reductase

Locus: BSU_08650

Molecular weight: 27.03 kDa

Isoelectric point: 5.97

Protein length: 250 aa

Gene length: 753 bp

Function: fatty acid biosynthesis

Product: enoyl-acyl carrier protein reductase

Essential: no

Synonyms: fabL, yfhR, ygaA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1028 (Galperin et al., 2021)

Gene

Coordinates: 937,079  937,831

The protein

Catalyzed reaction/ biological activity

• 2,3-saturated acyl-[ACP] + NADP⁺ --> (2E)-enoyl-[ACP] + H⁺ + NADPH (according to UniProt)

Protein family

• Short-chain dehydrogenases/reductases (SDR) family (according to UniProt)

Structure

• 3OIC (PDB) PubMed
• P71079 (AlphaFold)

Paralogous protein(s)

• FabI, one of the two proteins has to be present for viability PubMed
  YcdF, (31.6%)
  YhdF, (30.1%)
  YkvO, (31,8%)

Expression and Regulation

Operons

• Genes: fabL-sspE

  Description: PubMed

  Regulation

  • repressed by casamino acids PubMed

  Regulatory mechanism

  • SpoVT: repression, in spoVT regulon
  • YfhP: repression, in yfhP regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigG: sigma factor, PubMed, in sigG regulon

• Genes: mutY-fabL-sspE

  Description: PubMed

  Regulation

  • expression is constitutive throughout growth PubMed

  Regulatory mechanism

  • YfhP: repression, in yfhP regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

• MGNA-C324 (yfhR::erm), available at the NBRP B. subtilis, Japan
• BKE08650 (fabL::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTTCCTCATCTCCTTG,  downstream forward: _UP4_TAAAAATTTTTAAAAAAGAG
• BKK08650 (fabL::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTTCCTCATCTCCTTG,  downstream forward: _UP4_TAAAAATTTTTAAAAAAGAG

References

Reviews

Fujita Y, Matsuoka H, Hirooka K Regulation of fatty acid metabolism in bacteria. Molecular microbiology. 2007 Nov; 66(4):829-39. . PMID:17919287
White SW, Zheng J, Zhang YM, Rock The structural biology of type II fatty acid biosynthesis. Annual review of biochemistry. 2005; 74:791-831. . PMID:15952903

Original Publications

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Vick JE, Clomburg JM, Blankschien MD, Chou A, Kim S, Gonzalez R Escherichia coli enoyl-acyl carrier protein reductase (FabI) supports efficient operation of a functional reversal of β-oxidation cycle. Applied and environmental microbiology. 2015 Feb; 81(4):1406-16. . PMID:25527535
Kim KH, Ha BH, Kim SJ, Hong SK, Hwang KY, Kim EE Crystal structures of Enoyl-ACP reductases I (FabI) and III (FabL) from B. subtilis. Journal of molecular biology. 2011 Feb 25; 406(3):403-15. doi:10.1016/j.jmb.2010.12.003. PMID:21185310
Thomaides HB, Davison EJ, Burston L, Johnson H, Brown DR, Hunt AC, Errington J, Czaplewski L Essential bacterial functions encoded by gene pairs. Journal of bacteriology. 2007 Jan; 189(2):591-602. . PMID:17114254
Steil L, Serrano M, Henriques AO, Völker U Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology (Reading, England). 2005 Feb; 151(Pt 2):399-420. . PMID:15699190
Heath RJ, Su N, Murphy CK, Rock CO The enoyl-[acyl-carrier-protein] reductases FabI and FabL from Bacillus subtilis. The Journal of biological chemistry. 2000 Dec 22; 275(51):40128-33. . PMID:11007778
Yamamoto H, Mori M, Sekiguchi J Transcription of genes near the sspE locus of the Bacillus subtilis genome. Microbiology (Reading, England). 1999 Aug; 145 ( Pt 8):2171-80. . PMID:10463184
Bagyan I, Hobot J, Cutting S A compartmentalized regulator of developmental gene expression in Bacillus subtilis. Journal of bacteriology. 1996 Aug; 178(15):4500-7. . PMID:8755877