rodZ

168

required for proper septum positioning during vegetative growth (cell shape determination), part of the Rod complex for lateral cell wall synthesis and control of cell diameter

Locus: BSU_16910

Molecular weight: 23.48 kDa

Isoelectric point: 4.68

Protein length: 288 aa

Gene length: 867 bp

Function: septum positioning during vegetative growth

Product: morphogenic protein

Essential: yes

Synonyms: rodZ, ymfM

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1426 (Galperin et al., 2021)

Gene

Coordinates: 1,761,707  1,762,573

Phenotypes of a mutant

• essential PubMed
• depletion results in the formation of shorter and rounder cells PubMed
• depletion results in disturbed formation of asymmetric septa and perturbed SigF activation PubMed
• hypersensitivity to sorbic acid stress PubMed
• small, round, DNA-containing cells PubMed
• the mutant cells are thicker and longer than wild type cells PubMed

The protein

Catalyzed reaction/ biological activity

• the presence of RodZ-P results in increased MreB filament density and growth rate PubMed

Domains

• N-terminal cytoplasmic domain (RodZn), a transmembrane domain, and C-terminal extra-cytoplasmic domain (RodZc) PubMed

Structure

• 3FYM (PDB) (from Staphylococcus aureus, corresponds to aa 1 ... 112, 31% identity)
• O31771 (AlphaFold)

Modification

• phosphorylation by PrkC in response to lipid II abundance PubMed

Localization

• membrane protein (according to UniProt)

Additional information

• overexpression results in growth inhibition in minimal medium (in the absence of Mg2+ ) PubMed
• RodZ is destabilized in a ''mreB'' mutant PubMed

Expression and Regulation

Operons

• Genes: ymfK/1-ymfK/2-rodZ

  Description: PubMed

Biological materials

Mutant

• MGNA-B120 (ymfM::erm), available at the NBRP B. subtilis, Japan
• BKE16910 (rodZ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG,  downstream forward: _UP4_TAATTACCAGATGACTTTTC
• BKK16910 (rodZ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG,  downstream forward: _UP4_TAATTACCAGATGACTTTTC

Labs working on this gene/protein

• Adriano Henriques, Lisbon, Portugal  homepage

References

Reviews

Straume D, Piechowiak KW, Kjos M, Sigve Håvarstein LClass A PBPs: it is time to rethink traditional paradigms.Molecular microbiology. 2021 Mar 11; . PMID: 33709487

Original Publications

Dersch S, Graumann PLAdaptation of Bacillus subtilis MreB Filaments to Osmotic Stress Depends on Influx of Potassium Ions.Microorganisms. 2024 Jun 27; 12(7). PMID: 39065078
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Sun Y, Hürlimann S, Garner EGrowth rate is modulated by monitoring cell wall precursors in Bacillus subtilis.Nature microbiology. 2023 Mar; 8(3):469-480. PMID: 36797487
Dion MF, Kapoor M, Sun Y, Wilson S, Ryan J, Vigouroux A, van Teeffelen S, Oldenbourg R, Garner EC Bacillus subtilis cell diameter is determined by the opposing actions of two distinct cell wall synthetic systems. Nature microbiology. 2019 Aug; 4(8):1294-1305. doi:10.1038/s41564-019-0439-0. PMID:31086310
Cleverley RM, Rutter ZJ, Rismondo J, Corona F, Tsui HT, Alatawi FA, Daniel RA, Halbedel S, Massidda O, Winkler ME, Lewis RJ The cell cycle regulator GpsB functions as cytosolic adaptor for multiple cell wall enzymes. Nature communications. 2019 Jan 16; 10(1):261. doi:10.1038/s41467-018-08056-2. PMID:30651563
Muchová K, Chromiková Z, Valenčíková R, Barák I Interaction of the Morphogenic Protein RodZ with the Bacillus subtilis Min System. Frontiers in microbiology. 2017; 8:2650. doi:10.3389/fmicb.2017.02650. PMID:29403445
van Beilen J, Blohmke CJ, Folkerts H, de Boer R, Zakrzewska A, Kulik W, Vaz FM, Brul S, Ter Beek A RodZ and PgsA Play Intertwined Roles in Membrane Homeostasis of Bacillus subtilis and Resistance to Weak Organic Acid Stress. Frontiers in microbiology. 2016; 7:1633. . PMID:27818647
Muchová K, Chromiková Z, Bradshaw N, Wilkinson AJ, Barák I Morphogenic Protein RodZ Interacts with Sporulation Specific SpoIIE in Bacillus subtilis. PloS one. 2016; 11(7):e0159076. doi:10.1371/journal.pone.0159076. PMID:27415800
Pereira AC, Paiva A, Saraiva IH, Costa T, Henriques AO, Matzapetakis M Chemical shift assignments and secondary structure determination of the ectodomain of Bacillus subtilis morphogenic protein RodZ. Biomolecular NMR assignments. 2015 Oct; 9(2):285-8. doi:10.1007/s12104-014-9593-8. PMID:25503291
Muchová K, Chromiková Z, Barák I Control of Bacillus subtilis cell shape by RodZ. Environmental microbiology. 2013 Dec; 15(12):3259-71. doi:10.1111/1462-2920.12200. PMID:23879732
Garner EC, Bernard R, Wang W, Zhuang X, Rudner DZ, Mitchison T Coupled, circumferential motions of the cell wall synthesis machinery and MreB filaments in B. subtilis. Science (New York, N.Y.). 2011 Jul 08; 333(6039):222-5. doi:10.1126/science.1203285. PMID:21636745
Domínguez-Escobar J, Chastanet A, Crevenna AH, Fromion V, Wedlich-Söldner R, Carballido-López R Processive movement of MreB-associated cell wall biosynthetic complexes in bacteria. Science (New York, N.Y.). 2011 Jul 08; 333(6039):225-8. doi:10.1126/science.1203466. PMID:21636744
Alyahya SA, Alexander R, Costa T, Henriques AO, Emonet T, Jacobs-Wagner C RodZ, a component of the bacterial core morphogenic apparatus. Proceedings of the National Academy of Sciences of the United States of America. 2009 Jan 27; 106(4):1239-44. doi:10.1073/pnas.0810794106. PMID:19164570