fur

168

transcription regulator of iron homoeostasis in response to iron availability

Locus: BSU_23520

Molecular weight: 17.26 kDa

Isoelectric point: 5.37

Protein length: 149 aa

Gene length: 450 bp

Function: regulation of iron homoeostasis

Product: transcriptional repressor Fur family

Essential: no

Synonyms: fur, yqkL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0735 (Galperin et al., 2021)

Gene

Coordinates: 2,449,841 → 2,450,290

Phenotypes of a mutant

• no growth with glucose and ammonium as single sources of carbon and nitrogen, respectively (due to FsrA-mediated repression of the ''gltA-gltB'' operon)  PubMed
• poor growth on lactate as single carbon source (due to overexpression of FsrA-mediated repression of the ''lutA-lutB-lutC operon, can be suppressed by inactivation of fsrA or fbpB'')  PubMed
• severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C PubMed
• transcription profile of a ''fur'' mutant strain: GEO PubMed

The protein

Catalyzed reaction/ biological activity

• binds promoter regions of genes and operons of the Fur regulon to repress or stimulate transcription of the target genes PubMed

Protein family

• Fur family (according to UniProt)

Structure

• 4ETS (PDB) (from Campylobacter jejuni, 33% identity) PubMed
• P54574 (AlphaFold)

Effectors of protein activity

• DNA binding activity (repression) is triggered in the presence of Fe²⁺ PubMed
• in the absence of Fe²⁺, apo-Fpa binds to Fur and prevents its activity PubMed

Paralogous protein(s)

• PerR, Zur

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: fur

  Description: PubMed

  Regulation

  • repressed in the absence of hydrogen peroxide (PerR) PubMed

  Regulatory mechanism

  • PerR: repression, PubMed, in perR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP879 (fur::mls) and GP868 (fur::mls, perR::spc), available in Jörg Stülke's lab
• GP3321 (Δfur::mls Δfpa::cat), available in Jörg Stülke's lab
• HB6543 (aphA3), available in the John Helmann's lab
• MGNA-C426 (fur::erm), available at the NBRP B. subtilis, Japan
• 1A910 ( fur::kan), PubMed, available at BGSC
• BKE23520 (Δfur::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC,  downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
• BKK23520 (Δfur::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC,  downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA

Expression vectors

• pGP3589 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), pGP3869, pGP3871, pGP3873, pGP3875, available in Jörg Stülke's lab

FLAG-tag construct

• pGP3899 (C-terminal FLAG tag, based on pGP1331)

LacZ fusion

• pGP3592 (based on pAC7), available in Jörg Stülke's lab

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage

References

Reviews

Loading

Other original publications

Loading

The Fur regulon

Loading