citB

168

aconitase, trigger enzyme

Locus: BSU_18000

Molecular weight: 99.14 kDa

Isoelectric point: 4.9

Protein length: 909 aa

Gene length: 2730 bp

Function: TCA cycle

Product: aconitase, trigger enzyme

Essential: no

E.C.: 4.2.1.3

Synonyms: citB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Carbon core metabolism, TCA cycle

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of branched-chain amino acids

Information processing, Regulation of gene expression, Trigger enzyme, Trigger enzyme that acts by binding of a specific RNA element

Information processing, Regulation of gene expression, RNA binding regulators

List of homologs in different organisms, belongs to COG1048 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpA regulon, CodY regulon, CcpC regulon, CitB regulon

Gene

Coordinates: 1,926,680 1,929,409

Phenotypes of a mutant

glutamate auxotrophy and a defect in sporulation PubMed

The protein

Catalyzed reaction/ biological activity

Citrate --> isocitrate (according to UniProt)
3-hydroxybutane-1,2,3-tricarboxylate --> 2-methyl-cis-aconitate + H₂O (according to UniProt)
Binding to iron responsive elements (IRE RNA) in the absence of the FeS cluster PubMed
2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle PubMed

Protein family

aconitase/IPM isomerase family (with LeuC, according to UniProt)

Cofactors

FeS cluster PubMed

Structure

2B3X (PDB) (the human enzyme, 53% identity) PubMed
P09339 (AlphaFold)

Additional information

CitB is degraded in the forespore using MdfA as the adaptor protein PubMed
B. subtilis aconitase is both an enzyme and an RNA binding protein (moonlighting protein) PubMed
extensive information on the structure and enzymatic properties of CitB can be found at Proteopedia
belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

Genes: citB-yneN

Description: PubMed

Regulation

expressed upon transition into the stationary phase (AbrB) PubMed, indirect negative regulation by AbrB PubMed

Regulatory mechanism

CodY: repression, PubMed, in codY regulon
CcpC: repression, (molecular inducer: citrate) PubMed PubMed, in ccpC regulon
CcpA: repression, PubMed, in ccpA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Other regulations

FsrA: translation repression, PubMed

Biological materials

Mutant

GP1275 (citB::erm), available in Jörg Stülke's lab
GP1441 (citB::spec), available in Jörg Stülke's lab
1A999 (citB::spec), PubMed, available at BGSC
GP2338 (citB::kan, Cre-recombinase is integrated in sacA), available in Jörg Stülke's lab
GP2339 (citB::lox72, Cre-recombinase is integrated in sacA), available in Jörg Stülke's lab
BKE18000 (citB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
BKK18000 (citB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG

Expression vectors

pFM1, expression of CitB with a cleavable His₆-tag at the C-terminus in E. coli, based on pBAD30, available in Jörg Stülke's lab PubMed
pGP939, expression in E. coli, based on pBluescript, available in Jörg Stülke's lab
pGP1810, expression of Strep-CitB in E. coli, based on pGP172, available in Jörg Stülke's lab

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

GP1144 citB-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab
GP1145 citB-3xFLAG kan, available in Jörg Stülke's lab

LacZ fusion

pGP700 (cat, based on pAC5]), available in Jörg Stülke's lab

Antibody

available in Linc Sonenshein's lab

GFP fusion

GP1434 (spc, based on pGP1870), available in Jörg Stülke's lab

Labs working on this gene/protein

Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading