greA

168

transcription elongation factor, resolves stalled RNA polymerase at promoter or promoter-proximal regions

Locus: BSU_27320

Molecular weight: 17.00 kDa

Isoelectric point: 4

Protein length: 157 aa

Gene length: 474 bp

Function: transcription elongation

Product: transcription elongation factor

Essential: no

Synonyms: greA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0782 (Galperin et al., 2021)

Gene

Coordinates: 2,791,494  2,791,967

Phenotypes of a mutant

• RNA polymerase accumulates in promoter-proximal regions of many genes PubMed
• loss of genetic competence PubMed
• defective in Swarming motility (prolonged period of immotility prior to Swarming) PubMed

The protein

Catalyzed reaction/ biological activity

• resolves stalled RNA polymerase at promoter or promoter-proximal regions
• required for repair of DNA lesions during growth PubMed
• promotes error-prone DNA repair during stress to promote genetic diversity PubMed

Protein family

• GreA/GreB family (single member, according to UniProt)

Structure

• 1GRJ (PDB) (from E. coli, 43% identity) PubMed
• P80240 (AlphaFold)

Localization

• uniformly distributed throughout the nucleoid PubMed

Expression and Regulation

Operons

• Genes: trmR-yrrN-yrrO-udk-greA

  Description: PubMed

• Genes: greA

  Description: PubMed

Biological materials

Mutant

• BP351 (greA::cat) available in Fabian Commichau's lab
• GP2612 (ΔgreA::aphA3) available in Jörg Stülke's lab PubMed
• BKE27320 (''greA::ermC'') (available in the BGSC and in Jörg Stülke's lab)
• BKE27320 (greA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT,  downstream forward: _UP4_TAATATCTGTTTAGCAGCGA
• BKK27320 (greA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTCCCTTCACTCCTTCT,  downstream forward: _UP4_TAATATCTGTTTAGCAGCGA

Expression vectors

• C-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP382: pGP2547, available in Jörg Stülke's lab PubMed

FLAG-tag construct

• GP2525 (in pBP43), expression of  greA-FLAG::spc under the native promoter, available in Jörg Stülke's lab

LacZ fusion

• pGP2546 in (pAC7), available in Jörg Stülke's lab
• GP2537 (kan), available in Jörg Stülke's lab

GFP fusion

• GP2527 (in pBP43), expression of  greA-GFP::spc under the native promoter, available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading