ltaS

168

major polyglycerolphosphate lipoteichoic acid synthase, required for proper colony development

Locus: BSU_07710

Molecular weight: 74.05 kDa

Isoelectric point: 5.2

Protein length: 649 aa

Gene length: 1950 bp

Function: biosynthesis of lipoteichoic acid

Product: major lipoteichoic acid synthase

Essential: no

E.C.: 2.7.8.-

Synonyms: ltaS, yflE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall synthesis, Biosynthesis of lipoteichoic acid

Cellular processes, Cell envelope and cell division, Cell shape

Metabolism, Additional metabolic pathways, Biosynthesis of cell wall components, Biosynthesis of lipoteichoic acid

Groups of genes, Secreted proteins

Groups of genes, Membrane proteins

Groups of genes, Phosphoproteins, Phosphorylation on a Thr residue

List of homologs in different organisms, belongs to COG1368 (Galperin et al., 2021)

Gene

Coordinates: 842,047  843,996

Phenotypes of a mutant

induction of SigM and SigX activities PubMed
reduced SigD-dependent expression of ''lytF'' PubMed
extended lag phase PubMed
reduced colony size with accumulation of dead cells in the colonies PubMed
suppression of the growth and morphology defects of a glmR mutant PubMed
poor growth of ltaS ftsE and ltaS ftsX double mutants PubMed
poor growth of a ltaS cwlO double mutant PubMed
inactivation suppresses the essentiality of mbl PubMed

The protein

Protein family

LTA synthase family (according to UniProt)

Cofactors

Mn(2+) PubMed

Structure

2W8D (PDB) PubMed
O34952 (AlphaFold)

Modification

phosphorylated on Thr-297 PubMed
can be phosphorylated by PrkC in vitro PubMed

Paralogous protein(s)

YvgJ, YfnI, YqgS

Localization

cell membrane, at the septum of the cell  PubMed
extracellular (signal peptide) PubMed

Expression and Regulation

Operons

Genes: ltaS

Description: PubMed

Biological materials

Mutant

MGNA-C256 (yflE::erm), available at the NBRP B. subtilis, Japan
GP1389 ltaS::aphA3, available in Jörg Stülke's lab
GP1396 ltaS::tet, available in Jörg Stülke's lab
BKE07710 (ltaS::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGTTACACTCCTTTTTT,  downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT
BKK07710 (ltaS::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGTTACACTCCTTTTTT,  downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT

References

Reviews

Loading

Original Publications

Loading