bmrB

168

regulatory leader peptide for the control of bmrC-bmrD expression

Locus: BSU_09700

Molecular weight: 6.18 kDa

Isoelectric point: 11.08

Protein length: 53 aa

Gene length: 162 bp

Function: control of bmrC-bmrD expression

Product: leader peptide

Essential: no

Synonyms: bmrB, yheJ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 1,045,037 → 1,045,198

The protein

Structure

• O07551 (AlphaFold)

Expression and Regulation

Operons

• Genes: bmrB-bmrX-bmrC-bmrD

  Description: PubMed

  Regulation

  • bmrB-bmrX-bmrC-bmrD expression only occurs during the late-exponential and stationary growth stages (AbrB) PubMed
  • RNA processing in the intergenic region between bmrB and bmrC (in bmrX) (Rae1) PubMed

  Expression

  • expression is increased upon depletion of depletion of tRNA maturation factors rnpB or rnz PubMed

  Regulatory mechanism

  • AbrB: repression, PubMed, in abrB regulon
  • BmrB: attenuation, PubMed, in bmrB regulon

Biological materials

Mutant

• MGNA-A706 (yheJ::erm), available at the NBRP B. subtilis, Japan
• BKE09700 (ΔbmrB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGCAAATTCCTTGGCATA,  downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
• BKK09700 (ΔbmrB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGCAAATTCCTTGGCATA,  downstream forward: _UP4_TAAGGAAAGACAGGTGTATG

References

Deves V, Trinquier A, Gilet L, Alharake J, Condon C, Braun FShut down of multidrug transporter bmrCD mRNA expression mediated by the ribosome associated endoribonuclease Rae1 cleavage in a new cryptic ORF.RNA (New York, N.Y.). 2023 May 4; . PMID: 37142436
Trinquier A, Condon C, Braun FEffect of tRNA Maturase Depletion on Levels and Stabilities of Ribosome Assembly Cofactor and Other mRNAs in Bacillus subtilis.Microbiology spectrum. 2023 Feb 22; :e0513422. PMID: 36840557
Reilman E, Mars RA, van Dijl JM, Denham EL The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism. Nucleic acids research. 2014 Oct; 42(18):11393-407. doi:10.1093/nar/gku832. PMID:25217586
Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675