aimA

168

general amino acid importer, low affinity symporter for glutamate/H⁺, serine/H⁺, asparagine/H⁺, glycine[metabolite|]/H⁺, diaminopropionic acid/H⁺, alanine/H⁺, and beta-alanine/H⁺

Locus: BSU_02120

Molecular weight: 59.03 kDa

Isoelectric point: 9.82

Protein length: 539 aa

Gene length: 1620 bp

Function: low affinity uptake of serine, glutamate, asparagine, glycine, alanine, and beta-alanine

Product: amino acid importer A

Essential: no

Synonyms: aimA, ybeC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0531 (Galperin et al., 2021)

Gene

Coordinates: 231,348  232,967

Phenotypes of a mutant

• resistant to serine PubMed
• inactivation of aimA facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate PubMed
• a aimA aimB bcaP triple mutant is resistant to diaminopropionic acid PubMed
• a aimA alaP double mutant is resistant to L-alanine PubMed
• a aimA alaP double mutant is resistant to beta-alanine PubMed
• a aimA mutant is resistant to glycine PubMed

The protein

Catalyzed reaction/ biological activity

• uptake of serine PubMed, glutamate PubMed, asparagine PubMed, glycine PubMed, diaminopropionic acid PubMed, alanine PubMed, and beta-alanine PubMed (symport with H⁺)

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

• 6F2G (PDB) from Carnobacterium sp. AT7, 24.8% identity PubMed
• Q45577 (AlphaFold)

Kinetic information

• K_S for glutamate:
• - 3.2 mM (at external KCl concentration of 0.1 mM) PubMed
• - 2.3 mM (at external KCl concentration of 5 mM) PubMed

Paralogous protein(s)

• YveA

Localization

• membrane PubMed

Expression and Regulation

Operons

• Genes: aimA

  Description: PubMed

Biological materials

Mutant

• GP3590 (ΔaimA::phleo), available in Jörg Stülke's lab PubMed
• GP1886 ΔaimA::cat, available in Jörg Stülke's lab PubMed
• GP2786 ΔaimA::aphA3, available in Jörg Stülke's lab PubMed
• MGNA-B963 (ybeC::erm), available at the NBRP B. subtilis, Japan
• BKE02120 (aimA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCGTAAACACCTTTCA,  downstream forward: _UP4_TAAAATATAGAAGAAAACCT
• BKK02120 (aimA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCGTAAACACCTTTCA,  downstream forward: _UP4_TAAAATATAGAAGAAAACCT
• GP2831 (Δ''gltT::aphA3 Δ''''aimA::phleo''), available in Jörg Stülke's lab

FLAG-tag construct

• GP3062 ybeC-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

LacZ fusion

• pGP2287 (in pAC5) (GP2965), available in Jörg Stülke's lab PubMed

References

Loading