rpmH

168

ribosomal protein bL34

Locus: BSU_41060

Molecular weight: 5.00 kDa

Isoelectric point: 13

Protein length: 44 aa

Gene length: 135 bp

Function: translation

Product: ribosomal protein L34 (bL34)

Essential: no

Synonyms: rpmH

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Translation, Ribosomal proteins

List of homologs in different organisms, belongs to COG0230 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, DnaA regulon

Gene

Coordinates: 4,215,255 → 4,215,389

Phenotypes of a mutant

severe slow-growth phenotype, suppressed by disruption of ''mpfA or overexpression of mgtE'' PubMed
increased fraction of hyperpolarized cells (35.2% vs. 3.7% in the wild type) PubMed
the ribosomes are destabilized PubMed
severely impaired for growth in the presence of 1.2 M NaCl PubMed

The protein

Catalyzed reaction/ biological activity

required for efficient 70S-ribosome formation PubMed

Protein family

bacterial ribosomal protein bL34 family (single member, according to UniProt)

Structure

3J9W (PDB) (the ribosome) PubMed
P05647 (AlphaFold)

Localization

ribosome

Additional information

this ribosomal protein is lacking in some bacteria PubMed

Expression and Regulation

Operons

Genes: rpmH

Description: PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Genes: rpmH-rnpA-yidC1-jag

Description: PubMed

Regulation

expression is reduced in motile cells as compared to non-motile cells PubMed

Genes: arrA-rpmH

Description: PubMed

Regulatory mechanism

DnaA: repression, PubMed, in dnaA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKK41060 (ΔrpmH::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTATGACACCTCCCTCG,  downstream forward: _UP4_TAGGCCACTGAATAATGTCA

References

Wendel BM, Pi H, Krüger L, Herzberg C, Stülke J, Helmann JDA Central Role for Magnesium Homeostasis during Adaptation to Osmotic Stress.mBio. 2022 Feb 15; :e0009222. PMID: 35164567
Syvertsson S, Wang B, Staal J, Gao Y, Kort R, Hamoen LWDifferent resource allocation in a Bacillus subtilis population displaying bimodal motility.Journal of bacteriology. 2021 Mar 29; . PMID: 33782055
Galperin MY, Wolf YI, Garushyants SK, Vera Alvarez R, Koonin EVNon-essential ribosomal proteins in bacteria and archaea identified using COGs.Journal of bacteriology. 2021 Mar 22; . PMID: 33753464
Lee DD, Galera-Laporta L, Bialecka-Fornal M, Moon EC, Shen Z, Briggs SP, Garcia-Ojalvo J, Süel GM Magnesium Flux Modulates Ribosomes to Increase Bacterial Survival. Cell. 2019 Feb 28; . pii:S0092-8674(19)30105-9. doi:10.1016/j.cell.2019.01.042. PMID:30853217
Sohmen D, Chiba S, Shimokawa-Chiba N, Innis CA, Berninghausen O, Beckmann R, Ito K, Wilson DN Structure of the Bacillus subtilis 70S ribosome reveals the basis for species-specific stalling. Nature communications. 2015 Apr 23; 6:6941. doi:10.1038/ncomms7941. PMID:25903689
Akanuma G, Kobayashi A, Suzuki S, Kawamura F, Shiwa Y, Watanabe S, Yoshikawa H, Hanai R, Ishizuka M Defect in the formation of 70S ribosomes caused by lack of ribosomal protein L34 can be suppressed by magnesium. Journal of bacteriology. 2014 Nov; 196(22):3820-30. doi:10.1128/JB.01896-14. PMID:25182490
Akanuma G, Nanamiya H, Natori Y, Yano K, Suzuki S, Omata S, Ishizuka M, Sekine Y, Kawamura F Inactivation of ribosomal protein genes in Bacillus subtilis reveals importance of each ribosomal protein for cell proliferation and cell differentiation. Journal of bacteriology. 2012 Nov; 194(22):6282-91. doi:10.1128/JB.01544-12. PMID:23002217
Irnov I, Sharma CM, Vogel J, Winkler WC Identification of regulatory RNAs in Bacillus subtilis. Nucleic acids research. 2010 Oct; 38(19):6637-51. doi:10.1093/nar/gkq454. PMID:20525796
Lauber MA, Running WE, Reilly JP B. subtilis ribosomal proteins: structural homology and post-translational modifications. Journal of proteome research. 2009 Sep; 8(9):4193-206. doi:10.1021/pr801114k. PMID:19653700
Ogasawara N, Moriya S, Yoshikawa H Structure and function of the region of the replication origin of the Bacillus subtilis chromosome. IV. Transcription of the oriC region and expression of DNA gyrase genes and other open reading frames. Nucleic acids research. 1985 Apr 11; 13(7):2267-79. . PMID:2987848
Moriya S, Ogasawara N, Yoshikawa H Structure and function of the region of the replication origin of the Bacillus subtilis chromosome. III. Nucleotide sequence of some 10,000 base pairs in the origin region. Nucleic acids research. 1985 Apr 11; 13(7):2251-65. . PMID:2987847