alaT

168

PLP-dependent L-alanine aminotransferase

Locus: BSU_31400

Molecular weight: 42.15 kDa

Isoelectric point: 5.11

Protein length: 386 aa

Gene length: 1161 bp

Function: biosynthesis of L-alanine

Product: PLP-dependent L-alanine aminotransferase

Essential: no

Synonyms: alaT, yugH

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0436 (Galperin et al., 2021)

Gene

Coordinates: 3,225,772  3,226,932

Phenotypes of a mutant

• strongly impaired growth in the absence of alanine PubMed
• a alaT dat double mutant is auxotrophic for alanine PubMed

The protein

Catalyzed reaction/ biological activity

• pyruvate + glutamate --> L-alanine + 2-oxoglutarate PubMed

Protein family

• class-I pyridoxal-phosphate-dependent aminotransferase family (according to UniProt)

Structure

• 1DJU (PDB) (from Pyrococcus horikoshii, 47% identity) PubMed
• Q795M6 (AlphaFold)

Paralogous protein(s)

• AspB, PatA

Expression and Regulation

Operons

• Genes: alaR-alaT

  Description: PubMed

  Additional information

  • A ncRNA is predicted between yugI and alaT PubMed

Biological materials

Mutant

• GP3594 (ΔalaT::phleo), available in Jörg Stülke's lab
• GP3575 (ΔalaT::kan), available in Jörg Stülke's lab
• MGNA-A621 (yugH::erm), available at the NBRP B. subtilis, Japan
• BKE31400 (alaT::erm  trpC2) available at BGSC and in Jörg Stülke's lab,  PubMed, upstream reverse: _UP1_ATAGTCTGATAAATACGAAG,  downstream forward: _UP4_TAAAAAAAGATACGAACCTT
• BKK31400 (alaT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATAGTCTGATAAATACGAAG,  downstream forward: _UP4_TAAAAAAAGATACGAACCTT

References

Loading