ccpN

168

transcriptional repressor (CcpN family) of gluconeogenetic genes and of sr1, repression in the presence of glucose, involved in the control of cell elongation

Locus: BSU_25250

Molecular weight: 23.72 kDa

Isoelectric point: 7.22

Protein length: 212 aa

Gene length: 639 bp

Function: repressor of genes involved in gluconeogenesis (gapB, pckA) and of sr1

Product: transcriptional regulator (CcpN family)

Essential: no

Synonyms: ccpN, yqzB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Carbon core metabolism, Gluconeogenesis

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

Information processing, Regulation of gene expression, Regulators of core metabolism

List of homologs in different organisms, belongs to COG2905 (Galperin et al., 2021)

This gene is a member of the following regulons

CcpN regulon

Gene

Coordinates: 2,604,959  2,605,597

Phenotypes of a mutant

Impaired growth on glucose due to re-routing of carbon from glycolysis to the pentose phosphate pathway PubMed

The protein

Catalyzed reaction/ biological activity

transcription repression of the gapB, pckA, and sr1 genes in the presence of glucose PubMed

Protein family

CcpN family

Domains

HTH deoR-type domain (aa 6-70) (according to UniProt)
2 CBS domains (aa 83-139, aa 148-211) (according to UniProt)

Structure

3FV6 (PDB) (the CBS domains, aa 63 ... 212)
O34994 (AlphaFold)

Effectors of protein activity

YqfL (negative effector of CcpN activity) PubMed
ATP enhances CcpN-dependent repression, ADP counteracts the repressing activity of CcpN PubMed

Expression and Regulation

Operons

Genes: ccpN-yqfL

Description: PubMed

Regulation

constitutive PubMed

Additional information

the intracellular concentration of CcpN is about 4 myM (according to PubMed).

Biological materials

Mutant

GP3407 (ΔccpN::kan) , available in Jörg Stülke's lab
GP1678 (Δ(ccpN-yqfL::aphA3 trpC2), available in Jörg Stülke's lab
MGNA-C493 (yqzB::erm), available at the NBRP B. subtilis, Japan
DB104 ccpN::cat, available in Sabine Brantl's lab
GP1128 ccpN::cat, available in Jörg Stülke's lab
BKE25250 (ccpN::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCACCTTTTCACTTCATA,  downstream forward: _UP4_TAAGATTGCAAACTAACGGG
BKK25250 (ccpN::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCACCTTTTCACTTCATA,  downstream forward: _UP4_TAAGATTGCAAACTAACGGG

Expression vectors

pGP2923 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

available in Sabine Brantl's lab

Labs working on this gene/protein

Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France
Sabine Brantl, Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany homepage
Uwe Sauer, ETH Zrich, Switzerland homepage

References

Reviews

Brantl S, Licht A Characterisation of Bacillus subtilis transcriptional regulators involved in metabolic processes. Current protein & peptide science. 2010 Jun; 11(4):274-91. . PMID:20408793

Original Publications

Sharma K, Sultana T, Dahms TES, Dillon JRCcpN: a moonlighting protein regulating catabolite repression of gluconeogenic genes in Bacillus subtilis also affects cell length and interacts with DivIVA.Canadian journal of microbiology. 2020 Aug 7; :1-10. PMID: 32762636
Declerck N, Royer CA Interactions in gene expression networks studied by two-photon fluorescence fluctuation spectroscopy. Methods in enzymology. 2013; 519:203-30. doi:10.1016/B978-0-12-405539-1.00007-5. pii:B978-0-12-405539-1.00007-5. PMID:23280112
Ferguson ML, Le Coq D, Jules M, Aymerich S, Radulescu O, Declerck N, Royer CA Reconciling molecular regulatory mechanisms with noise patterns of bacterial metabolic promoters in induced and repressed states. Proceedings of the National Academy of Sciences of the United States of America. 2012 Jan 03; 109(1):155-60. doi:10.1073/pnas.1110541108. PMID:22190493
Eckart RA, Brantl S, Licht A Search for additional targets of the transcriptional regulator CcpN from Bacillus subtilis. FEMS microbiology letters. 2009 Oct; 299(2):223-31. doi:10.1111/j.1574-6968.2009.01754.x. PMID:19732150
Licht A, Brantl S The transcriptional repressor CcpN from Bacillus subtilis uses different repression mechanisms at different promoters. The Journal of biological chemistry. 2009 Oct 30; 284(44):30032-8. doi:10.1074/jbc.M109.033076. PMID:19726675
Tännler S, Fischer E, Le Coq D, Doan T, Jamet E, Sauer U, Aymerich S CcpN controls central carbon fluxes in Bacillus subtilis. Journal of bacteriology. 2008 Sep; 190(18):6178-87. doi:10.1128/JB.00552-08. PMID:18586936
Licht A, Golbik R, Brantl S Identification of ligands affecting the activity of the transcriptional repressor CcpN from Bacillus subtilis. Journal of molecular biology. 2008 Jun 27; 380(1):17-30. doi:10.1016/j.jmb.2008.05.002. PMID:18511073
Licht A, Brantl S Transcriptional repressor CcpN from Bacillus subtilis compensates asymmetric contact distribution by cooperative binding. Journal of molecular biology. 2006 Dec 01; 364(3):434-48. . PMID:17011578
Licht A, Preis S, Brantl S Implication of CcpN in the regulation of a novel untranslated RNA (SR1) in Bacillus subtilis. Molecular microbiology. 2005 Oct; 58(1):189-206. . PMID:16164558
Servant P, Le Coq D, Aymerich S CcpN (YqzB), a novel regulator for CcpA-independent catabolite repression of Bacillus subtilis gluconeogenic genes. Molecular microbiology. 2005 Mar; 55(5):1435-51. . PMID:15720552