sigY

168

RNA polymerase ECF-type sigma factor SigY

Locus: BSU_38700

Molecular weight: 21.21 kDa

Isoelectric point: 9.55

Protein length: 178 aa

Gene length: 537 bp

Function: maintenance of the SP prophage

Product: RNA polymerase ECF-type sigma factor SigY

Essential: no

Synonyms: sigY, yxlB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, RNA synthesis and degradation, Transcription, Sigma factors

Information processing, Regulation of gene expression, Sigma factors and their control, Sigma factors

Lifestyles, Coping with stress, Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

List of homologs in different organisms, belongs to COG1595 (Galperin et al., 2021)

This gene is a member of the following regulons

SigY regulon

Gene

Coordinates: 3,970,312  3,970,848

Phenotypes of a mutant

loss of the [[SP prophage]] PubMed
sensitive to killing by Sublancin]] PubMed
no production of  Sublancin]] PubMed

The protein

Protein family

Sigma-70 factor family (according to UniProt)
ECF subfamily (according to UniProt)

Structure

5WUQ (PDB) (the SigW-RsiW complex, 30% identity) PubMed
P94370 (AlphaFold)

Expression and Regulation

Operons

Genes: sigY-yxlC-yxlD-yxlE-yxlF-yxlG

Description: PubMed

Sigma factors

SigY: sigma factor, PubMed, in sigY regulon

Biological materials

Mutant

MGNA-B751 (sigY::erm), available at the NBRP B. subtilis, Japan
1A909 ( sigY::erm), PubMed, available at BGSC
BKE38700 (sigY::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGACCGTGATCCCCCCT,  downstream forward: _UP4_CAGCAAATCAGAAAGGAGTG
BKK38700 (sigY::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGACCGTGATCCCCCCT,  downstream forward: _UP4_CAGCAAATCAGAAAGGAGTG

References

Reviews

Loading

Other original publications

Loading

The SigY regulon

Loading