ymfC

168

similar to transcriptional regulator (GntR family)

Locus: BSU_16810

Molecular weight: 27.75 kDa

Isoelectric point: 6.4

Protein length: 241 aa

Gene length: 726 bp

Function: unknown

Product: transcriptional regulator (GntR family)

Essential: no

Synonyms: ymfC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2188 (Galperin et al., 2021)

Gene

Coordinates: 1,754,785 → 1,755,510

The protein

Protein family

• GntR family of transcription factors

Domains

• HTH gntR-type domain (aa 8-76) (according to UniProt)

Structure

• 2WV0 (PDB) (NagR, corresponds to aa 83 ... 307 of YmfC, 30% identity)
• O31761 (AlphaFold)

Paralogous protein(s)

• GamR, NagR, GmuR, FrlR, TreR

Expression and Regulation

Operons

• Genes: ymfC

  Description: PubMed

• Genes: spoIIIE-ymfC

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-B115 (ymfC::erm), available at the NBRP B. subtilis, Japan
• BKE16810 (ΔymfC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTCCCCTCCGTAAAC,  downstream forward: _UP4_TAAAAACGGACGCCTGTATG
• BKK16810 (ΔymfC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTCCCCTCCGTAAAC,  downstream forward: _UP4_TAAAAACGGACGCCTGTATG

References

Leyn SA, Kazanov MD, Sernova NV, Ermakova EO, Novichkov PS, Rodionov DA Genomic reconstruction of the transcriptional regulatory network in Bacillus subtilis. Journal of bacteriology. 2013 Jun; 195(11):2463-73. doi:10.1128/JB.00140-13. PMID:23504016
Resch M, Schiltz E, Titgemeyer F, Muller YA Insight into the induction mechanism of the GntR/HutC bacterial transcription regulator YvoA. Nucleic acids research. 2010 Apr; 38(7):2485-97. doi:10.1093/nar/gkp1191. PMID:20047956