exoA

168

apurinic/apyrimidinic endonuclease, multifunctional DNA-repair enzyme, important for spore dormance

Locus: BSU_40880

Molecular weight: 29.10 kDa

Isoelectric point: 4.59

Protein length: 252 aa

Gene length: 759 bp

Function: repair of oxidative DNA damage in spores

Product: apurinic/apyrimidinic endonuclease

Essential: no

Synonyms: exoA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0708 (Galperin et al., 2021)

Gene

Coordinates: 4,197,780  4,198,538

Phenotypes of a mutant

• reduced formation of rpsB or rpsE suppressor mutants after mitomycin treatment PubMed
• an ''fenA nfo double mutant is impaired in germination and spore outgrowth due to the accumulation of DNA lesions, this can be rescued by inactivation of disA'' PubMed
• an ''fenA nfo'' double mutant is sensitive to radiation PubMed
• sensitive to blue light-induced DNA damage PubMed
• reduced resistance towards electron beams PubMed

The protein

Catalyzed reaction/ biological activity

• Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
• binds to 8-oxoG, abasic, and RNA base DNA lesions PubMed

Protein family

• DNA repair enzymes AP/ExoA family (single member, according to UniProt)

Structure

• 5CFE (PDB) PubMed
• P37454 (AlphaFold)

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: exoA-ccpB

  Description: (according to DBTBS) null

  Regulation

  • expressed late during sporulation in the forespore (SigG) PubMed

  Sigma factors

  • SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

• GP898 (ΔexoA::kan), available in Jörg Stülke's lab PubMed
• GP1503 (ΔexoA::kan nfo::cat), available in Jörg Stülke's lab PubMed
• BKE40880 (ΔexoA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT,  downstream forward: _UP4_TGATGAGATAGCAGTAAGGA
• BKK40880 (ΔexoA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT,  downstream forward: _UP4_TGATGAGATAGCAGTAAGGA

References

Reviews

Loading

Original Publications

Loading