aerA

168

transcription activator, amino acid export regulator A (AraC family)

Locus: BSU_05150

Molecular weight: 34.07 kDa

Isoelectric point: 6.87

Protein length: 291 aa

Gene length: 876 bp

Function: control of amino acid export

Product: amino acid export regulator A

Essential: no

E.C.: null

Synonyms: ydeC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2207 (Galperin et al., 2021)

Gene

Coordinates: 561,514  562,389

The protein

Catalyzed reaction/ biological activity

• the protein is inactive under most conditions, if activated (either by mutations or by 2,3-diaminopropionic acid) activation of aexA expression PubMed

Protein family

• AraC family

Domains

• HTH araC/xylS-type domain (aa 191-289) (according to UniProt)

Structure

• P96660 (AlphaFold)

Expression and Regulation

Operons

• Genes: aerA-ydzE

  Description: PubMed

Biological materials

Mutant

• GP4117 (trpC2 aerA ^Y179D), available in Jörg Stülke's lab PubMed
• GP4119 (trpC2 aerA ^L122W), available in Jörg Stülke's lab PubMed
• GP4498 (trpC2 ΔaerA::neo), available in Jörg Stülke's lab
• MGNA-C079 (ydeC::erm), available at the NBRP B. subtilis, Japan
• BKE05150 (aerA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTGACTTCACACCTCA,  downstream forward: _UP4_TAAAGTTTATTCTATTAATA
• BKK05150 (aerA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTGACTTCACACCTCA,  downstream forward: _UP4_TAAAGTTTATTCTATTAATA

LacZ fusion

• GP4439, kana, (based on pAC7), available in Jörg Stülke's lab PubMed
• GP4441, cat, (based on pAC5), available in Jörg Stülke's lab

References

Loading