rhaB
168
rhamnulokinase
locus
BSU_31200
Molecular weight
54.57 kDa
pI
5.42
function
utilization of rhamnose
product
rhamnulokinase
essential
no
ec
2.7.1.5
synonyms
rhaB, yulC
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1070 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,199,565 3,201,022
The protein
Catalyzed reaction/ biological activity
L-rhamnulose + ATP --> L-rhamnulose-1-phosphate + ADP [Pubmed|26712933]
Protein family
rhamnulokinase family (single member, according to UniProt)
Structure
[PDB|2UYT] (the enzyme of ''E. coli'')
[AF|O05262]
Expression and Regulation
Operons
genes
[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|26712933,22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]: repression, [Pubmed|26712933], in [regulon|protein:F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|26712933], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26712933], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
genes
[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
Biological materials
Mutant
MGNA-B545 (yulC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1544 NBRP B. subtilis, Japan]
BKE31200 ([gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATGGCAGTATAAATCA, downstream forward: _UP4_AAATGATGAAGAGGTGAAAA
BKK31200 ([gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATGGCAGTATAAATCA, downstream forward: _UP4_AAATGATGAAGAGGTGAAAA
References
Page visits: 3894
Time of last update: 2025-10-23 20:18:33
Author of last update: Jstuelk