adaB

168

O6-methylguanine-DNA methyltransferase

Locus: BSU_01820

Molecular weight: 19.98 kDa

Isoelectric point: 6.15

Protein length: 179 aa

Gene length: 540 bp

Function: adaptive response to alkylative DNA damage

Product: O6-methylguanine-DNA methyltransferase

Essential: no

E.C.: 2.1.1.63

Synonyms: adaB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0350 (Galperin et al., 2021)

Gene

Coordinates: 204,351 → 204,890

The protein

Catalyzed reaction/ biological activity

• 6-O-methyl-2'-deoxyguanosine in DNA + L-cysteinyl-[protein] --> 2'-deoxyguanosine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
• 4-O-methyl-thymidine in DNA + L-cysteinyl-[protein] --> thymidine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)

Protein family

• MGMT family (with Ogt, according to UniProt)

Structure

• 4BHB (PDB) (from Mycobacterium tuberculosis, 42% identity) PubMed
• P19220 (AlphaFold)

Expression and Regulation

Operons

• Genes: adaA-adaB

  Description: PubMed

  Regulation

  • positive control by AdaA PubMed

  Regulatory mechanism

  • AdaA: activation, in adaA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• BKE01820 (ΔadaB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAGTAAAGACCAATAAAGGG,  downstream forward: _UP4_TGAAAGTGAATCATCTATAA
• BKK01820 (ΔadaB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAGTAAAGACCAATAAAGGG,  downstream forward: _UP4_TGAAAGTGAATCATCTATAA

References

Reviews

Mielecki D, Grzesiuk E Ada response - a strategy for repair of alkylated DNA in bacteria. FEMS microbiology letters. 2014 Jun; 355(1):1-11. doi:10.1111/1574-6968.12462. PMID:24810496
Lenhart JS, Schroeder JW, Walsh BW, Simmons LA DNA repair and genome maintenance in Bacillus subtilis. Microbiology and molecular biology reviews : MMBR. 2012 Sep; 76(3):530-64. doi:10.1128/MMBR.05020-11. PMID:22933559

Original Publications

Miggiano R, Casazza V, Garavaglia S, Ciaramella M, Perugino G, Rizzi M, Rossi F Biochemical and structural studies of the Mycobacterium tuberculosis O6-methylguanine methyltransferase and mutated variants. Journal of bacteriology. 2013 Jun; 195(12):2728-36. doi:10.1128/JB.02298-12. PMID:23564173
Morohoshi F, Hayashi K, Munakata N Bacillus subtilis ada operon encodes two DNA alkyltransferases. Nucleic acids research. 1990 Sep 25; 18(18):5473-80. . PMID:2120677