nfrA

168

Spx-dependent FMN-containing NADPH-linked nitro/flavin reductase, stress protein

Locus: BSU_38110

Molecular weight: 28.17 kDa

Isoelectric point: 5.73

Protein length: 249 aa

Gene length: 750 bp

Function: unknown

Product: FMN-containing NADPH-linked nitro/flavin reductase

Essential: no

Synonyms: nfrA, ywcG, ipa-43d

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0778 (Galperin et al., 2021)

Gene

Coordinates: 3,911,477  3,912,226

The protein

Catalyzed reaction/ biological activity

• possesses an NADH oxidase activity that leads to high concentrations of oxygen peroxide and an NAD( ) degrading activity leading to free nicotinamide PubMed
• FMNH₂ + NADP⁺ --> FMN + 2 H⁺ + NADPH (according to UniProt)

Protein family

• flavin oxidoreductase frp family (with YcnD, according to UniProt)

Cofactors

• FMN or FAD PubMed

Structure

• 3N2S (PDB) PubMed
• P39605 (AlphaFold)

Expression and Regulation

Operons

• Genes: nfrA-ywcH

  Description: PubMed

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed
  • induced by cell wall stress (Spx) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon
  • Spx: activation, PubMed, in spx regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• MGNA-B232 (ywcG::erm), available at the NBRP B. subtilis, Japan
• BKE38110 (nfrA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCACAAAAACCTCCTTAT,  downstream forward: _UP4_TAAAGCAAACCTCTCCGTCT
• BKK38110 (nfrA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCACAAAAACCTCCTTAT,  downstream forward: _UP4_TAAAGCAAACCTCTCCGTCT

References

Loading