argB

168

N-acetylglutamate 5-phosphotransferase

Locus: BSU_11210

Molecular weight: 27.57 kDa

Isoelectric point: 6.21

Protein length: 258 aa

Gene length: 777 bp

Function: biosynthesis of arginine

Product: N-acetylglutamate 5-phosphotransferase (a.k.a. acetylglutamate kinase)

Essential: no

E.C.: 2.7.2.8

Synonyms: argB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0548 (Galperin et al., 2021)

Gene

Coordinates: 1,197,326  1,198,102

The protein

Catalyzed reaction/ biological activity

• ATP + N-acetyl-L-glutamate --> ADP + N-acetyl-L-glutamyl 5-phosphate (according to UniProt)

Protein family

• acetylglutamate kinase family (single member, according to UniProt)

Structure

• 2BTY (PDB) (from Thermotoga maritima, 45% identity) PubMed
• P68729 (AlphaFold)

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: argC-argJ-argB-argD-carA-carB-argF

  Description: PubMed

  Regulation

  • repressed by arginine (AhrC) PubMed
  • induced in the absence of RnpM PubMed

  Regulatory mechanism

  • AhrC: repression, PubMed, in ahrC regulon
  • CodY: repression, PubMed, in codY regulon
  • RnpM: unknown, PubMed, in rnpM regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP2481 (argB::ermC), available in Jörg Stülke's lab
• GP2856 (argB::aphA3), available in Jörg Stülke's lab
• BKE11210 (''argB::ermC'') (available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE11210 (argB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTCTTCATTTCGCTCCCCT,  downstream forward: _UP4_GTCAAAGCAAAGGAGGCTGT
• BKK11210 (argB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTCTTCATTTCGCTCCCCT,  downstream forward: _UP4_GTCAAAGCAAAGGAGGCTGT

Expression vectors

• pGP3010: expression of Strep-argB by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3011: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab
• pGP3012: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• pGP3854: expression of argB (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Loading