pgi

168

glucose 6-phosphate isomerase, glycolytic / gluconeogenic enzyme

Locus: BSU_31350

Molecular weight: 50.36 kDa

Isoelectric point: 4.85

Protein length: 451 aa

Gene length: 1353 bp

Function: enzyme in glycolysis / gluconeogenesis

Product: glucose-6-phosphate isomerase

Essential: no

E.C.: 5.3.1.9

Synonyms: pgi, yugL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0166 (Galperin et al., 2021)

Gene

Coordinates: 3,220,731 3,222,083

Phenotypes of a mutant

• poorly transformable PubMed
• a zwf pgi double mutant is unable to grow on minimal medium in the presence of glucose (due to the accumulation of toxic glucose-1-phosphate) PubMed
• a zwf pgi pgcA triple mutant is not viable PubMed

The protein

Catalyzed reaction/ biological activity

• aldehydo-D-glucose-6-P --> keto-D-fructose-6-P (according to UniProt)

Protein family

• GPI family (single member, according to UniProt)

Structure

• 1B0Z (PDB) (Geobacillus stearothermophilus), 2PGI (Geobacillus stearothermophilus)
• P80860 (AlphaFold)

Modification

• phosphorylation on Thr-39 PubMed
• phosphorylated on Arg-5 PubMed

Effectors of protein activity

• competitively inhibited by 6-phosphogluconate (in B.caldotenax, B.stearothermophilus) PubMed

Localization

• cytoplasm (homogeneously distributed throughout the cell) PubMed

Additional information

• extensive information on the structure and enzymatic properties of Pgi can be found at Proteopedia
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: pgi-yugM-yugN

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• GP508 (spc), available in Jrg Stlke's lab, PubMed
• GP1746: BSB1 pgi::aphA3, available in Jrg Stlke' lab
• BKE31350 (pgi::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGCTTGTCCCTCCATAA, downstream forward: _UP4_TAATGTGAGAAAGCTGACTG
• BKK31350 (pgi::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGCTTGTCCCTCCATAA, downstream forward: _UP4_TAATGTGAGAAAGCTGACTG

Expression vectors

• pGP398 (N-terminal His-tag, in pWH844), available in Jrg Stlke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab, PubMed

LacZ fusion

• pGP510 (in pAC6), available in Jrg Stlke's lab

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany homepage

References

Loading

Original Publications

Loading