pyk

168

pyruvate kinase, glycolytic enzyme, involved in control of DNA replication

Locus: BSU_29180

Molecular weight: 62.00 kDa

Isoelectric point: 4.88

Protein length: 585 aa

Gene length: 1758 bp

Function: catabolic enzyme in glycolysis, control of DNA replication

Product: pyruvate kinase

Essential: no

E.C.: 2.7.1.40

Synonyms: pyk, pykA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3848 (Galperin et al., 2021)

Gene

Coordinates: 2,984,788 → 2,986,545

Phenotypes of a mutant

• unable to grow with non-PtsI carbohydrates (such as glucitol or  glycerol) as single carbon source
• suppression of ''ftsZ''(ts) mutation (reverted by addition of pyruvate) PubMed
• the mutant cells are thinner and shorter than wild type cells PubMed
• a ndk pyk double mutant is unable to grow on minimal medium with glucose due to lack of NTP production PubMed
• inactivation of pyk can overcome the toxicity of guanosine to a rel sasA sasB triple mutant PubMed

The protein

Catalyzed reaction/ biological activity

• ADP + PEP → ATP + pyruvate PubMed
• GDP + PEP → GTP + pyruvate PubMed
• UDP + PEP → UTP + pyruvate PubMed
• CDP + PEP → CTP + pyruvate PubMed
• The reaction is irreversible under physiological conditions

Protein family

• C-terminal part: PEP-utilizing enzyme family (according to UniProt)
• pyruvate kinase family (single member, according to UniProt)

Domains

• extra C-terminal domain (ECTD): aa 475 - 585 PubMed

Cofactors

• Mg2+, K+

Structure

• 2E28 (PDB) (Geobacillus stearothermophilus) PubMed
• P80885 (AlphaFold)

Modification

• phosphorylation on Ser36 PubMed, PubMed, phosphorylation on Ser536 or Ser546 PubMed, please note that the Ser is not on position 536 but rather at 538

Effectors of protein activity

• activated by PEP (Hill Coefficient 1,8) PubMed PubMed
• allosterically activated by AMP, this requires the extra C-terminal domain PubMed
• activation by r5p and ADP, this requires the extra C-terminal domain PubMed
• inhibition by ADP and fructose-1,6-bisphosphate in high concentrations; and ATP, this requires the extra C-terminal domain PubMed

Localization

• cytoplasm PubMed

Additional information

• the enzyme is a tetramer with four active sites PubMed
• belongs to the 100 most abundant proteins PubMed
• the enzyme is inhibited under gluconeogenetic conditions PubMed

Expression and Regulation

Operons

• Genes: pfkA-pyk-ytzA

  Description: PubMed

  Regulation

  • twofold induced by glucose PubMed

Biological materials

Mutant

• GP589 (pyk::cat), available in Jörg Stülke's lab, PubMed
• GP600 (pyk::erm), available in Jörg Stülke's lab, PubMed
• GP1745: BSB1 pyk::aphA3, available in Jörg Stülke' lab
• BKE29180 (Δpyk::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT,  downstream forward: _UP4_TAATTACAGGTGAAAATGGA
• BKK29180 (Δpyk::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT,  downstream forward: _UP4_TAATTACAGGTGAAAATGGA

Expression vectors

• expression in E. coli, N-terminal His-tag: pGP1100 (in pWH844), available in Jörg Stülke's lab, PubMed
• expression in B. subtilis, native protein: pGP1411 (in pBQ200), available in Jörg Stülke's lab
• expression in B. subtilis, N-terminal Strep-tag: pGP1409 (in pGP380), available in Jörg Stülke's lab
• expression in B. subtilis, C-terminal Strep-tag: pGP1410 (in pGP382), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

LacZ fusion

• see ''pfkA

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

She F, Liu K, Anderson BW, Pisithkul T, Li Y, Fung DK, McCue T, Mulhern W, Amador-Noguez D, Wang JDPyruvate kinase directly generates GTP in glycolysis, supporting growth and contributing to guanosine toxicity.mBio. 2025 Feb 25; :e0379824. PMID: 39998177
She F, Anderson BW, Khana DB, Zhang S, Steinchen W, Fung DK, Lesser NG, Lucas LN, Stevenson DM, Astmann TJ, Bange G, van Pijkeren J-P, Amador-Noguez D, Wang JDAllosteric regulation of pyruvate kinase enables efficient and robust gluconeogenesis by preventing metabolic conflicts and carbon overflow.mSystems. 2025 Jan 28; :e0113124. PMID: 39873491
Holland A, Pitoulias M, Soultanas P, Janniere LThe Replicative DnaE Polymerase of Bacillus subtilis Recruits the Glycolytic Pyruvate Kinase (PykA) When Bound to Primed DNA Templates.Life (Basel, Switzerland). 2023 Apr 7; 13(4). PMID: 37109494
Horemans S, Pitoulias M, Holland A, Pateau E, Lechaplais C, Ekaterina D, Perret A, Soultanas P, Janniere LPyruvate kinase, a metabolic sensor powering glycolysis, drives the metabolic control of DNA replication.BMC biology. 2022 Apr 13; 20(1):87. PMID: 35418203
Juillot D, Cornilleau C, Deboosere N, Billaudeau C, Evouna-Mengue P, Lejard V, Brodin P, Carballido-López R, Chastanet AA High-Content Microscopy Screening Identifies New Genes Involved in Cell Width Control in Bacillus subtilis.mSystems. 2021 Nov 30; :e0101721. PMID: 34846166
Sousa J, Westhoff P, Methling K, Lalk M The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in . Metabolites. 2019 Oct 04; 9(10). pii:E216. doi:10.3390/metabo9100216. PMID:31590319
de Jong L, de Koning EA, Roseboom W, Buncherd H, Wanner MJ, Dapic I, Jansen PJ, van Maarseveen JH, Corthals GL, Lewis PJ, Hamoen LW, de Koster CG In-Culture Cross-Linking of Bacterial Cells Reveals Large-Scale Dynamic Protein-Protein Interactions at the Peptide Level. Journal of proteome research. 2017 Jul 07; 16(7):2457-2471. doi:10.1021/acs.jproteome.7b00068. PMID:28516784
Monahan LG, Hajduk IV, Blaber SP, Charles IG, Harry EJ Coordinating bacterial cell division with nutrient availability: a role for glycolysis. mBio. 2014 May 13; 5(3):e00935-14. doi:10.1128/mBio.00935-14. pii:e00935-14. PMID:24825009
Kohlstedt M, Sappa PK, Meyer H, Maaß S, Zaprasis A, Hoffmann T, Becker J, Steil L, Hecker M, van Dijl JM, Lalk M, Mäder U, Stülke J, Bremer E, Völker U, Wittmann C Adaptation of Bacillus subtilis carbon core metabolism to simultaneous nutrient limitation and osmotic challenge: a multi-omics perspective. Environmental microbiology. 2014 Jun; 16(6):1898-917. doi:10.1111/1462-2920.12438. PMID:24571712
Licona-Cassani C, Lara AR, Cabrera-Valladares N, Escalante A, Hernández-Chávez G, Martinez A, Bolívar F, Gosset G Inactivation of pyruvate kinase or the phosphoenolpyruvate: sugar phosphotransferase system increases shikimic and dehydroshikimic acid yields from glucose in Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2014; 24(1):37-45. doi:10.1159/000355264. PMID:24158146
Commichau FM, Pietack N, Stülke J Essential genes in Bacillus subtilis: a re-evaluation after ten years. Molecular bioSystems. 2013 Jun; 9(6):1068-75. doi:10.1039/c3mb25595f. PMID:23420519
Cabrera-Valladares N, Martínez LM, Flores N, Hernández-Chávez G, Martínez A, Bolívar F, Gosset G Physiologic consequences of glucose transport and phosphoenolpyruvate node modifications in Bacillus subtilis 168. Journal of molecular microbiology and biotechnology. 2012; 22(3):177-97. doi:10.1159/000339973. PMID:22846916
Brown CT, Fishwick LK, Chokshi BM, Cuff MA, Jackson JM, Oglesby T, Rioux AT, Rodriguez E, Stupp GS, Trupp AH, Woollcombe-Clarke JS, Wright TN, Zaragoza WJ, Drew JC, Triplett EW, Nicholson WL Whole-genome sequencing and phenotypic analysis of Bacillus subtilis mutants following evolution under conditions of relaxed selection for sporulation. Applied and environmental microbiology. 2011 Oct; 77(19):6867-77. doi:10.1128/AEM.05272-11. PMID:21821766
Suzuki K, Ito S, Shimizu-Ibuka A, Sakai H Crystal structure of pyruvate kinase from Geobacillus stearothermophilus. Journal of biochemistry. 2008 Sep; 144(3):305-12. doi:10.1093/jb/mvn069. PMID:18511452
Eymann C, Becher D, Bernhardt J, Gronau K, Klutzny A, Hecker M Dynamics of protein phosphorylation on Ser/Thr/Tyr in Bacillus subtilis. Proteomics. 2007 Oct; 7(19):3509-26. . PMID:17726680
Jannière L, Canceill D, Suski C, Kanga S, Dalmais B, Lestini R, Monnier AF, Chapuis J, Bolotin A, Titok M, Le Chatelier E, Ehrlich SD Genetic evidence for a link between glycolysis and DNA replication. PloS one. 2007 May 16; 2(5):e447. . PMID:17505547
Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, Jensen PR, Mann M The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Molecular & cellular proteomics : MCP. 2007 Apr; 6(4):697-707. . PMID:17218307
Lévine A, Vannier F, Absalon C, Kuhn L, Jackson P, Scrivener E, Labas V, Vinh J, Courtney P, Garin J, Séror SJ Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr phosphoproteome implicated in a wide variety of cellular processes. Proteomics. 2006 Apr; 6(7):2157-73. . PMID:16493705
Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Büttner K, Buurman G, Scharf C, Venz S, Völker U, Hecker M A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics. 2004 Oct; 4(10):2849-76. . PMID:15378759
Ludwig H, Homuth G, Schmalisch M, Dyka FM, Hecker M, Stülke J Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon. Molecular microbiology. 2001 Jul; 41(2):409-22. . PMID:11489127
Fry B, Zhu T, Domach MM, Koepsel RR, Phalakornkule C, Ataai MM Characterization of growth and acid formation in a Bacillus subtilis pyruvate kinase mutant. Applied and environmental microbiology. 2000 Sep; 66(9):4045-9. . PMID:10966427
Diesterhaft M, Freese E Pyruvate kinase of bacillus subtilis. Biochimica et biophysica acta. 1972 May 12; 268(2):373-80. . PMID:4623707
Sakai H, Suzuki K, Imahori K Purification and properties of pyruvate kinase from Bacillus stearothermophilus. Journal of biochemistry. 1986 Apr; 99(4):1157-67. . PMID:3711058