ylxM

168

putative signal recognition particle (SRP) component

Locus: BSU_15970

Molecular weight: 13.02 kDa

Isoelectric point: 4.54

Protein length: 110 aa

Gene length: 333 bp

Function: presecretory protein translocation

Product: putative signal recognition particle (SRP) component

Essential: no

Synonyms: ylxM

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Protein secretion

List of homologs in different organisms, belongs to COG2739 (Galperin et al., 2021)

Gene

Coordinates: 1,671,828  1,672,160

The protein

Protein family

UPF0122 family (single member, according to UniProt)

Structure

1XSV (PDB) (from Staphylococcus aureus, 54% identity)
P37104 (AlphaFold)

Expression and Regulation

Operons

Genes: ylxM-ffh-rpsP-khpA

Description: PubMed

Regulation

the mRNA is processed between ffh and rpsP by RNase Y, this requires the RicA-RicF-RicT complex PubMed

Expression

expression is decreased upon depletion of tRNA maturation factors rnpB or rnz PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Genes: ylxM-ffh-rpsP-khpA-ylqD-rimM-trmD-rplS

Description: PubMed

Regulation

the mRNA is processed between ffh and rpsP by RNase Y, this requires the RicA-RicF-RicT complex PubMed

Expression

expression is decreased upon depletion of tRNA maturation factors rnpB or rnz PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE15970 (ylxM::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGAGCTCTCCCCTTTG,  downstream forward: _UP4_AAATTAGATTAGGAGGCGGC
BKK15970 (ylxM::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGAGCTCTCCCCTTTG,  downstream forward: _UP4_AAATTAGATTAGGAGGCGGC

References

Trinquier A, Condon C, Braun FEffect of tRNA Maturase Depletion on Levels and Stabilities of Ribosome Assembly Cofactor and Other mRNAs in Bacillus subtilis.Microbiology spectrum. 2023 Feb 22; :e0513422. PMID: 36840557
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Williams ML, Crowley PJ, Hasona A, Brady LJ YlxM is a newly identified accessory protein that influences the function of signal recognition particle pathway components in Streptococcus mutans. Journal of bacteriology. 2014 Jun; 196(11):2043-52. doi:10.1128/JB.01465-13. PMID:24659773
Honda K, Nakamura K, Nishiguchi M, Yamane K Cloning and characterization of a Bacillus subtilis gene encoding a homolog of the 54-kilodalton subunit of mammalian signal recognition particle and Escherichia coli Ffh. Journal of bacteriology. 1993 Aug; 175(15):4885-94. . PMID:8335643