recG

168

ATP-dependent DNA helicase, branch migration translocase, required for DNA repair and chromosomal segregation

Locus: BSU_15870

Molecular weight: 77.96 kDa

Isoelectric point: 7.09

Protein length: 682 aa

Gene length: 2049 bp

Function: DNA repair and chromosomal segregation

Product: ATP-dependent DNA helicase, branch migration translocase

Essential: no

Synonyms: recG, ylpB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1200 (Galperin et al., 2021)

Gene

Coordinates: 1,659,810  1,661,858

Phenotypes of a mutant

• a recD2 recG double mutant is not viable PubMed
• a recU recG double mutant is not viable PubMed
• a ruvA-ruvB recG mutant is not viable PubMed
• a recG radA double mutant is non-transformable with chromosomal DNA PubMed

The protein

Catalyzed reaction/ biological activity

• binds and unwinds Holliday junction DNA PubMed
• ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)

Protein family

• helicase family (according to UniProt)

Domains

• Helicase ATP-binding domain (aa 271-432) (according to UniProt)
• Helicase C-terminal domain (aa 451-611) (according to UniProt)

Structure

• 1GM5 (PDB) (from Thermotoga maritima, 43% identity, 62% similarity)
• O34942 (AlphaFold)

Effectors of protein activity

• RecG-mediated fork reversal and fork restoration are limited by DisA PubMed

Paralogous protein(s)

• Mfd

Localization

• associated with the replisome PubMed

Expression and Regulation

Operons

• Genes: sdaAB-sdaAA-recG

  Description: PubMed

Biological materials

Mutant

• 1A897 (no resistance), PubMed, available at BGSC
• BKE15870 (recG::erm  trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCAATACCCTTAATGTTAG,  downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
• BKK15870 (recG::kan  trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CCCAATACCCTTAATGTTAG,  downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG

References

Loading