yqaO
168
similar to phage-related protein
locus
BSU_26240
Molecular weight
7.48 kDa
pI
9.57
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqaO
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
2,692,645 2,692,851
The protein
Structure
[AF|P45912]
Biological materials
Mutant
BKE26240 ([gene|99C4008F5D74132B4763415AE8B22C69598B41E1|yqaO]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAAAGCGCCCCCTATG, downstream forward: _UP4_TGAGAAGAAGATATAATACT
BKK26240 ([gene|99C4008F5D74132B4763415AE8B22C69598B41E1|yqaO]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAAAGCGCCCCCTATG, downstream forward: _UP4_TGAGAAGAAGATATAATACT
References
Page visits: 2917
Time of last update: 2025-10-26 22:23:53
Author of last update: Bzhu