yqaO

yqaO
168

similar to phage-related protein

locus
BSU_26240
Molecular weight
7.48 kDa
pI
9.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqaO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,692,645  2,692,851
The protein
Structure
[AF|P45912]
Biological materials
Mutant
BKE26240 ([gene|99C4008F5D74132B4763415AE8B22C69598B41E1|yqaO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCAAAGCGCCCCCTATG,  downstream forward: _UP4_TGAGAAGAAGATATAATACT
BKK26240 ([gene|99C4008F5D74132B4763415AE8B22C69598B41E1|yqaO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTCAAAGCGCCCCCTATG,  downstream forward: _UP4_TGAGAAGAAGATATAATACT
References
20525796

99C4008F5D74132B4763415AE8B22C69598B41E1

Page visits: 2915

Time of last update: 2025-10-26 22:22:39

Author of last update: Bzhu