racA

168

cell division protein

Locus: BSU_37030

Molecular weight: 20.93 kDa

Isoelectric point: 9.51

Protein length: 184 aa

Gene length: 555 bp

Product: cell division protein

Essential: no

Synonyms: racA, ywkC

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell division, Other genes

List of homologs in different organisms, belongs to COG0789 (Galperin et al., 2021)

This gene is a member of the following regulons

Spo0A regulon, SigH regulon

Gene

Coordinates: 3,798,789  3,799,343

The protein

Protein family

racA family (single member, according to UniProt)

Domains

HTH merR-type domain (aa 75-156) (according to UniProt)

Structure

5I44 (PDB) (RacA-DN complex) PubMed
5I41 (PDB) (DNA-binding domain) PubMed
P45870 (AlphaFold)

Localization

cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: ywkD-racA

Description: PubMed

Genes: racA

Description: PubMed

Regulation

expressed under conditions that trigger sporulation (Spo0A) PubMed

Regulatory mechanism

Spo0A: activation, PubMed, in spo0A regulon

Sigma factors

SigH: sigma factor, PubMed, in sigH regulon

Biological materials

Mutant

MGNA-B655 (ywkC::erm), available at the NBRP B. subtilis, Japan
BKE37030 (racA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATCCCATACCTCCTTT,  downstream forward: _UP4_TAAAGCAAAAAGCTCCCTTA
BKK37030 (racA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATCCCATACCTCCTTT,  downstream forward: _UP4_TAAAGCAAAAAGCTCCCTTA

References

Schumacher MA, Lee J, Zeng W Molecular insights into DNA binding and anchoring by the Bacillus subtilis sporulation kinetochore-like RacA protein. Nucleic acids research. 2016 Jun 20; 44(11):5438-49. doi:10.1093/nar/gkw248. PMID:27085804
van Baarle S, Celik IN, Kaval KG, Bramkamp M, Hamoen LW, Halbedel S Protein-protein interaction domains of Bacillus subtilis DivIVA. Journal of bacteriology. 2013 Mar; 195(5):1012-21. doi:10.1128/JB.02171-12. PMID:23264578
Marchadier E, Carballido-López R, Brinster S, Fabret C, Mervelet P, Bessières P, Noirot-Gros MF, Fromion V, Noirot P An expanded protein-protein interaction network in Bacillus subtilis reveals a group of hubs: Exploration by an integrative approach. Proteomics. 2011 Aug; 11(15):2981-91. doi:10.1002/pmic.201000791. PMID:21630458
Lenarcic R, Halbedel S, Visser L, Shaw M, Wu LJ, Errington J, Marenduzzo D, Hamoen LW Localisation of DivIVA by targeting to negatively curved membranes. The EMBO journal. 2009 Aug 05; 28(15):2272-82. doi:10.1038/emboj.2009.129. PMID:19478798
Ben-Yehuda S, Fujita M, Liu XS, Gorbatyuk B, Skoko D, Yan J, Marko JF, Liu JS, Eichenberger P, Rudner DZ, Losick R Defining a centromere-like element in Bacillus subtilis by Identifying the binding sites for the chromosome-anchoring protein RacA. Molecular cell. 2005 Mar 18; 17(6):773-82. . PMID:15780934
Fujita M, González-Pastor JE, Losick R High- and low-threshold genes in the Spo0A regulon of Bacillus subtilis. Journal of bacteriology. 2005 Feb; 187(4):1357-68. . PMID:15687200
Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R The Spo0A regulon of Bacillus subtilis. Molecular microbiology. 2003 Dec; 50(5):1683-701. . PMID:14651647
Wu LJ, Errington J RacA and the Soj-Spo0J system combine to effect polar chromosome segregation in sporulating Bacillus subtilis. Molecular microbiology. 2003 Sep; 49(6):1463-75. . PMID:12950914
Ben-Yehuda S, Rudner DZ, Losick R RacA, a bacterial protein that anchors chromosomes to the cell poles. Science (New York, N.Y.). 2003 Jan 24; 299(5606):532-6. . PMID:12493822
Ben-Yehuda S, Rudner DZ, Losick R RacA, a bacterial protein that anchors chromosomes to the cell poles. Science (New York, N.Y.). 2003 Jan 24; 299(5606):532-6. . PMID:12493822