yrrO

168

tRNA uridine hydroxylase (in complex with YrrN)

Locus: BSU_27340

Molecular weight: 47.46 kDa

Isoelectric point: 4.85

Protein length: 422 aa

Gene length: 1269 bp

Function: introduction of 5-methoxyuridine modification in tRNA (U34)

Product: tRNA uridine hydroxylase

Essential: no

E.C.: null

Synonyms: yrrO, trhP2

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0826 (Galperin et al., 2021)

Gene

Coordinates: 2,792,860 → 2,794,128

Phenotypes of a mutant

• 50% reduction in mo⁵U tRNA levels PubMed

The protein

Catalyzed reaction/ biological activity

• hydroxylation of U34 in tRNA to give 5-hydroxyuridine (ho⁵U) (in complex with YrrN) with prephenate as hydroxyl donor, ho⁵U is the precursor for 5-methoxyuridine modification (by TrmR)  PubMed

Protein family

• peptidase U32 family (with YrrN, according to UniProt)

Structure

• O32034 (AlphaFold)

Paralogous protein(s)

• YrrN

Expression and Regulation

Operons

• Genes: trmR-yrrN-yrrO-udk-greA

  Description: PubMed

Biological materials

Mutant

• MGNA-A007 (yrrO::erm), available at the NBRP B. subtilis, Japan
• BKE27340 (ΔyrrO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGCTTAACCTCCTTTTG,  downstream forward: _UP4_ATGAGAAAGGGGAAGTAACA
• BKK27340 (ΔyrrO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGCTTAACCTCCTTTTG,  downstream forward: _UP4_ATGAGAAAGGGGAAGTAACA

References

Research papers

Loading