ymaB

168

putative Nudix hydrolase, has RNA pyrophosphohydrolase activity

Locus: BSU_17400

Molecular weight: 23.24 kDa

Isoelectric point: 4.51

Protein length: 206 aa

Gene length: 621 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ymaB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG4112 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, ResD regulon, PerR regulon, NrdR regulon

Gene

Coordinates: 1,872,128  1,872,748

The protein

Structure

3E57 (PDB) (from Thermotoga maritima, 35% identity)
P50619 (AlphaFold)

Expression and Regulation

Operons

Genes: nrdI-nrdE-nrdF-ymaB

Description: PubMed

Regulation

expressed under anaerobic conditions (ResD) PubMed

Regulatory mechanism

ResD: activation, PubMed, in resD regulon
NrdR: repression, (predicted) PubMed, in nrdR regulon
PerR: transcription repression, PubMed, in perR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

A ncRNA is predicted between 'ymzA' and 'nrdI' PubMed

Genes: ymzA-nrdI-nrdE-nrdF-ymaB

Description: PubMed

Biological materials

Mutant

MGNA-B380 (ymaB::erm), available at the NBRP B. subtilis, Japan
BKE17400 (ymaB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGGGTACTGCGTCCTCCT,  downstream forward: _UP4_TAAAAAAACCCGGTTTCTCG
BKK17400 (ymaB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGGGTACTGCGTCCTCCT,  downstream forward: _UP4_TAAAAAAACCCGGTTTCTCG

References

Loading