pgcA

168

alpha-phosphoglucomutase, required for UDP-glucose synthesis, inhibits FtsZ ring assembly (indirect effect due to a defect in UDP-glucose synthesis), possesses a secondary phosphoglucosamine mutase activity

Locus: BSU_09310

Molecular weight: 62.73 kDa

Isoelectric point: 4.91

Protein length: 581 aa

Gene length: 1746 bp

Function: interconversion of glucose 6-phosphate and alpha-glucose 1-phosphate

Product: alpha-phosphoglucomutase

Essential: no

E.C.: 5.4.2.2

Synonyms: pgcA, yhxB, gtaC, gtaE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1109 (Galperin et al., 2021)

Gene

Coordinates: 1,006,774  1,008,519

Phenotypes of a mutant

• cells are bent and distended due to the lack of glucolipids PubMed
• the inactivation of ''pgcA suppresses the poor and filamentous growth of the whiA zapA'' double mutant PubMed
• inactivation of ''pgcA'' reduces sporulation efficiency to 0.1% that of wild type cells; smaller and wider mother cells with small forespores PubMed
• resistant to phage SPO1 PubMed
• a pgcA glmR double mutant is not viable, this can be suppressed by overexpression of GlmM PubMed
• a zwf pgi pgcA triple mutant is not viable PubMed
• defective in Swarming motility (prolonged period of immotility prior to Swarming) PubMed

The protein

Catalyzed reaction/ biological activity

• α-D-glucose 1-phosphate --> α-D-glucose 6-phosphate (according to UniProt)
• D-glucosamine 6-phosphate --> α-D-glucosamine 1-phosphate (secondary activity, this activity is increased by a G47S mutation) PubMed

Protein family

• phosphohexose mutase family (with GlmM, PubMed)

Structure

• 2Z0F (PDB) (from Thermus thermophilus, 27% identity)
• P18159 (AlphaFold)

Modification

• phosphorylated on ser/ thr/ tyr PubMed, PubMed

Additional information

• PgcA inhibits FtsZ ring assembly (indirect effect due to a defect in UDP-glucose synthesis)PubMed
• a PgcA (G47S) variant suppresses the growth defect of a glmR mutant on gluconeogenic carbon sources in the absence of glucose due to the increased phosphoglucosamine mutase activity PubMed

Expression and Regulation

Operons

• Genes: pgcA

  Description: PubMed

Biological materials

Mutant

• MGNA-B476 (yhxB::erm), available at the NBRP B. subtilis, Japan
• GP1743: BSB1 pgcA::aphA3, available in Jörg Stülke's lab
• BKE09310 (pgcA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTCGTCCTCCTATGTA,  downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
• BKK09310 (pgcA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTCGTCCTCCTATGTA,  downstream forward: _UP4_TAATTCAAGTATGAGCTGGG

References

Reviews

Loading

Original Publications

Loading