yhfE

168

similar to aminopeptidase

Locus: BSU_10200

Molecular weight: 38.58 kDa

Isoelectric point: 5.88

Protein length: 346 aa

Gene length: 1041 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yhfE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Poorly characterized/ putative enzymes

List of homologs in different organisms, belongs to COG1363 (Galperin et al., 2021)

Gene

Coordinates: 1,095,063 → 1,096,103

The protein

Protein family

Peptidase M42 family (with YsdC and YtoP, according to UniProt)

Structure

2GRE (PDB) (from Bacillus Cereus, 71% identity)
O07603 (AlphaFold)

Expression and Regulation

Operons

Genes: yhfE-yhfF

Description: PubMed

Biological materials

Mutant

MGNA-A710 (yhfE::erm), available at the NBRP B. subtilis, Japan
BKE10200 (ΔyhfE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGGGCATTCCTCCTTTT,  downstream forward: _UP4_CCAATGGTATAAGGGGGAGG
BKK10200 (ΔyhfE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGGGCATTCCTCCTTTT,  downstream forward: _UP4_CCAATGGTATAAGGGGGAGG