upp

168

uracil phosphoribosyltransferase

Locus: BSU_36890

Molecular weight: 22.89 kDa

Isoelectric point: 5.86

Protein length: 209 aa

Gene length: 630 bp

Function: UMP synthesis

Product: uracil phosphoribosyltransferase

Essential: no

E.C.: 2.4.2.9

Synonyms: upp, ipc-35d

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Nucleotide metabolism, Biosynthesis/ acquisition of nucleotides, Biosynthesis/ acquisition of pyrimidine nucleotides

List of homologs in different organisms, belongs to COG0035 (Galperin et al., 2021)

Gene

Coordinates: 3,788,426  3,789,055

The protein

Catalyzed reaction/ biological activity

diphosphate + UMP --> 5-phospho-α-D-ribose 1-diphosphate + uracil (according to UniProt)

Protein family

UPRTase family (single member, according to UniProt)

Structure

2EHJ (PDB) (from Escherichia coli, 52% identity, 73% similarity)
P39149 (AlphaFold)

Expression and Regulation

Operons

Genes: upp

Description: PubMed

Biological materials

Mutant

1A832 (no resistance), PubMed, available at BGSC
BKE36890 (upp::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTGTGTTTCAGCTCCT,  downstream forward: _UP4_TAAAAAATGAAATCCCCAAA
BKK36890 (upp::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTGTGTTTCAGCTCCT,  downstream forward: _UP4_TAAAAAATGAAATCCCCAAA

References

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Martinussen J, Glaser P, Andersen PS, Saxild HH Two genes encoding uracil phosphoribosyltransferase are present in Bacillus subtilis. Journal of bacteriology. 1995 Jan; 177(1):271-4. . PMID:7798145