sucD

168

succinyl-CoA synthetase (alpha subunit)

Locus: BSU_16100

Molecular weight: 31.23 kDa

Isoelectric point: 5.59

Protein length: 300 aa

Gene length: 903 bp

Function: TCA cycle

Product: succinyl-CoA synthetase (alpha subunit)

Essential: no

E.C.: 6.2.1.5

Synonyms: sucD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0074 (Galperin et al., 2021)

Gene

Coordinates: 1,681,617 1,682,519

The protein

Catalyzed reaction/ biological activity

• ATP + CoA + succinate --> ADP + phosphate + succinyl-CoA (according to UniProt)

Protein family

• succinate/malate CoA ligase alpha subunit family (single member, according to UniProt)

Structure

• 1JKJ (PDB) (E. coli)
• P80865 (AlphaFold)

Modification

• phosphorylation on (Ser-19 OR Thr-20) PubMed

Effectors of protein activity

• Inhibited by 2-oxoglutarate, ATP and NADH FEBS Letters
• GTP is not accepted by the enzyme FEBS Letters

Kinetic information

• Reversible Michaelis-Menten FEBS Letters

Additional information

• extensive information on the structure and enzymatic properties of succinyl-CoA synthetase can be found at Proteopedia
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: sucC-sucD-dprA-topA

  Description: PubMed

  Regulation

  • repressed by glucose (2.4-fold) (CcpA) PubMed
  • expression is heterogeneous PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in ccpA regulon

Biological materials

Mutant

• GP720 (spc), available in Jrg Stlke's lab
• 1A1008 ( sucD::spec), PubMed, available at BGSC
• GP791 (sucC-sucD)::tet, available in Jrg Stlke's lab
• GP2344 (sucC-sucD)::kan, Cre-recombinase is integrated in sacA, available in Jrg Stlke's lab
• GP2345 (sucC-sucD::lox72), Cre-recombinase is integrated in sacA, available in Jrg Stlke's lab
• BKE16100 (sucD)::erm trpC2 available at BGSC, PubMed, upstream reverse: _UP1_CATTATTTGGTCCCCTGCCT, downstream forward: _UP4_TAATAAAAAAGGGACAGCCG
• BKK16100 (sucD)::kan trpC2 available at BGSC, PubMed, upstream reverse: _UP1_CATTATTTGGTCCCCTGCCT, downstream forward: _UP4_TAATAAAAAAGGGACAGCCG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab

FLAG-tag construct

• GP1425 (spc, based on pGP1331), available in Jrg Stlke's lab

Antibody

• **

GFP fusion

• GP1435 (spc, based on pGP1870), available in Jrg Stlke's lab

References

Loading