rocD

168

ornithine transaminase

Locus: BSU_40340

Molecular weight: 43.60 kDa

Isoelectric point: 4.89

Protein length: 401 aa

Gene length: 1203 bp

Function: arginine, ornithine and citrulline utilization

Product: ornithine transaminase

Essential: no

E.C.: 2.6.1.13

Synonyms: rocD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4992 (Galperin et al., 2021)

Gene

Coordinates: 4,144,301 → 4,145,506

Phenotypes of a mutant

• unable to grow with arginine, ornithine, or citrulline as single source of nitrogen PubMed

The protein

Catalyzed reaction/ biological activity

• 2-oxocarboxylate + L-ornithine --> L-α-amino acid + L-glutamate 5-semialdehyde (according to UniProt)

Protein family

• Class-III pyridoxal-phosphate-dependent aminotransferase family (according to UniProt)

Cofactors

• PLP (according to UniProt)

Structure

• 3RUY (PDB) (from B. anthracis, 76% identity, 93% similarity)
• P38021 (AlphaFold)

Paralogous protein(s)

• ArgD, YhxA, GabT

Localization

• cytoplasm (according to UniProt)

Expression and Regulation

Operons

• Genes: rocD-rocE-rocF

  Description: PubMed

  Regulation

  • induced in the presence of arginine (AhrC) PubMed
  • induced in the presence of arginine, citrulline or ornithine (with ornithine as the molecular inducer) (RocR) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon
  • AhrC: activation, PubMed, in ahrC regulon
  • CodY: repression, PubMed, in codY regulon
  • RocR: activation, PubMed, in rocR regulon

  Sigma factors

  • SigL: sigma factor, PubMed, in sigL regulon

  Additional information

  • expression of the rocD-rocE-rocF operon is increased upon depletion of nusA (resulting from increased ahrC expression) Reference

Biological materials

Mutant

• GP4071 (ΔrocD trpC2), available in Jörg Stülke's lab
• GP656, aphA3, available in Jörg Stülke's lab PubMed
• BKE40340 (ΔrocD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTTGAATTCCCCCTTG,  downstream forward: _UP4_TAAATCCGCACCATGGCGGG
• BKK40340 (ΔrocD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTTGAATTCCCCCTTG,  downstream forward: _UP4_TAAATCCGCACCATGGCGGG

Expression vectors

• pGP3795: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• pGP3798: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab
• pGP3789: expression of Strep-rocD by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3795: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab PubMed
• pGP3860 (N-terminal GST-tag, purification from E. coli, in pGEX-6P-1), available in Jörg Stülke's lab

LacZ fusion

• GP4039, available in Jörg Stülke's lab PubMed

References

Loading