ptsI

168

Enzyme I, general (non sugar-specific) component of the PTS

Locus: BSU_13910

Molecular weight: 62.90 kDa

Isoelectric point: 4.59

Protein length: 570 aa

Gene length: 1713 bp

Function: PTS-dependent sugar transport

Product: phosphotransferase system (PTS) enzyme I

Essential: no

E.C.: 2.7.3.9

Synonyms: ptsI

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Phosphotransferase system, General PTS proteins

Information processing, Genetics, Newly identified competence genes

Groups of genes, Phosphoproteins, Phosphorylation on a His residue

Groups of genes, Phosphoproteins, Phosphorylation on a Ser residue

List of homologs in different organisms, belongs to COG1080 (Galperin et al., 2021)

Gene

Coordinates: 1,459,650 1,461,362

Phenotypes of a mutant

poorly transformable PubMed
inactivation suppresses the essentiality of mbl PubMed

The protein

Catalyzed reaction/ biological activity

L-histidyl-[protein] + phosphoenolpyruvate --> N-phospho-L-histidyl-[protein] + pyruvate (according to UniProt)
PEP-dependent autophosphorylation on His-189, transfer of the phosphoryl group to HPr]] (His-15)

Protein family

PEP-utilizing enzyme family (according to UniProt)

Domains

HPr binding site (N-Terminal Domain)
pyruvate binding site (C-Terminal Domain)
pyrophosphate/phosphate carrier histidine (central Domain)

Cofactors

Magnesium

Structure

2WQD (PDB) (Enzyme I from Staphylococcus aureus, 68% identity) PubMed
P08838 (AlphaFold)

Modification

transient autophosphorylation on His-189
in vivo also phosphorylated on Ser-34 or Ser-36 PubMed

Localization

cytoplasm, even distribution PubMed

Additional information

belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

Genes: ptsH-ptsI

Description: PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Genes: ptsG-ptsH-ptsI

Description: PubMed

Regulation

expression activated by glucose (2 fold) (GlcT) PubMed

Regulatory mechanism

stringent response: negative regulation, in stringent response
GlcT: antitermination, via the GlcT-dependent RNA switch PubMed, in glcT regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

available in Jörg Stülke's lab:
GP864 (ptsI::ermC)
GP778 (glcT-ptsG-ptsH-ptsI::spc) PubMed
BKE13910 (ptsI::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
BKK13910 (ptsI::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG

Expression vectors

pAG3 (His-tag) PubMed, available in Galinier lab
for expression, purification in E. coli (His-tag), in pWH844: pGP813 available in Jörg Stülke's lab

GFP fusion

GP1268, ptsI-cfp, available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Deutscher J, Aké FM, Derkaoui M, Zébré AC, Cao TN, Bouraoui H, Kentache T, Mokhtari A, Milohanic E, Joyet P The bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system: regulation by protein phosphorylation and phosphorylation-dependent protein-protein interactions. Microbiology and molecular biology reviews : MMBR. 2014 Jun; 78(2):231-56. doi:10.1128/MMBR.00001-14. PMID:24847021
Görke B, Stülke J Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nature reviews. Microbiology. 2008 Aug; 6(8):613-24. doi:10.1038/nrmicro1932. PMID:18628769
Deutscher J, Francke C, Postma PW How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiology and molecular biology reviews : MMBR. 2006 Dec; 70(4):939-1031. . PMID:17158705
Stülke J, Hillen W Regulation of carbon catabolism in Bacillus species. Annual review of microbiology. 2000; 54:849-80. . PMID:11018147
Stülke J, Hillen W Coupling physiology and gene regulation in bacteria: the phosphotransferase sugar uptake system delivers the signals. Die Naturwissenschaften. 1998 Dec; 85(12):583-92. . PMID:9871918

Original Publications

Koo BM, Todor H, Sun J, van Gestel J, Hawkins JS, Hearne CC, Banta AB, Huang KC, Peters JM, Gross CAComprehensive double-mutant analysis of the Bacillus subtilis envelope using double-CRISPRi.bioRxiv : the preprint server for biology. 2024 Aug 16; . PMID: 39185233
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell systems. 2017 Mar 22; 4(3):291-305.e7. pii:S2405-4712(16)30447-1. doi:10.1016/j.cels.2016.12.013. PMID:28189581
Govindarajan S, Elisha Y, Nevo-Dinur K, Amster-Choder O The general phosphotransferase system proteins localize to sites of strong negative curvature in bacterial cells. mBio. 2013 Oct 15; 4(5):e00443-13. doi:10.1128/mBio.00443-13. pii:e00443-13. PMID:24129255
Rothe FM, Wrede C, Lehnik-Habrink M, Görke B, Stülke J Dynamic localization of a transcription factor in Bacillus subtilis: the LicT antiterminator relocalizes in response to inducer availability. Journal of bacteriology. 2013 May; 195(10):2146-54. doi:10.1128/JB.00117-13. PMID:23475962
Tojo S, Kumamoto K, Hirooka K, Fujita Y Heavy involvement of stringent transcription control depending on the adenine or guanine species of the transcription initiation site in glucose and pyruvate metabolism in Bacillus subtilis. Journal of bacteriology. 2010 Mar; 192(6):1573-85. doi:10.1128/JB.01394-09. PMID:20081037
Oberholzer AE, Schneider P, Siebold C, Baumann U, Erni B Crystal structure of enzyme I of the phosphoenolpyruvate sugar phosphotransferase system in the dephosphorylated state. The Journal of biological chemistry. 2009 Nov 27; 284(48):33169-76. doi:10.1074/jbc.M109.057612. PMID:19801641
Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, Jensen PR, Mann M The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Molecular & cellular proteomics : MCP. 2007 Apr; 6(4):697-707. . PMID:17218307
Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Büttner K, Buurman G, Scharf C, Venz S, Völker U, Hecker M A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics. 2004 Oct; 4(10):2849-76. . PMID:15378759
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Garrity LF, Schiel SL, Merrill R, Reizer J, Saier MH, Ordal GW Unique regulation of carbohydrate chemotaxis in Bacillus subtilis by the phosphoenolpyruvate-dependent phosphotransferase system and the methyl-accepting chemotaxis protein McpC. Journal of bacteriology. 1998 Sep; 180(17):4475-80. . PMID:9721285