pfkA

168

phosphofructokinase, glycolytic enzyme

Locus: BSU_29190

Molecular weight: 34.10 kDa

Isoelectric point: 6.14

Protein length: 319 aa

Gene length: 960 bp

Function: catabolic enzyme in glycolysis

Product: 6-phosphofructokinase

Essential: no

E.C.: 2.7.1.11

Synonyms: pfkA, pfk

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0205 (Galperin et al., 2021)

Gene

Coordinates: 2,986,588  2,987,547

Phenotypes of a mutant

• essential according to PubMed, non-essential according to PubMed
• poor growth PubMed
• poorly transformable PubMed
• increased resistance to diamide PubMed

The protein

Catalyzed reaction/ biological activity

• ATP + β-D-fructose-6-P --> ADP + β-D-fructose-1,6-bisphosphate + H⁺ (according to UniProt)

Protein family

• phosphofructokinase type A (PFKA) family (single member, according to UniProt)

Domains

• 3 x nucleotide binding domain (ATP) (2125), (154158), (171187)

Cofactors

• Mg2+

Structure

• 4A3S (PDB) PubMed
• 1MTO (PDB) (mutant, complex with fructose-6-P, Geobacillus stearothermophilus)
• 4PFK (PDB) (Geobacillus stearothermophilus)
• O34529 (AlphaFold)

Modification

• phosphorylated on Arg-233 PubMed

Effectors of protein activity

• Inhibited by citrate, PEP (Hill Coefficient 3) and Ca2+ (competes with Mg2+) in B. licheniformes PubMed.
• Inhibited by ATP (competitively) and fructose-6-P (non-competitively) in G. stearothermophillus PubMed
• Activated by GDP and ADP in lower concentrations (1 mM); above that inhibition, competing with the ATP for the binding site (in G. stearothermophillus) PubMed
• Activated by NH4+ PubMed

Kinetic information

• Allosteric Regulation (Reversible) PubMed

Localization

• cytoplasm (homogeneous) PubMed

Additional information

• PfkA is a moonlighting protein PubMed
• extensive information on the structure and enzymatic properties of PfkA can be found at Proteopedia

Expression and Regulation

Operons

• Genes: pfkA-pyk-ytzA

  Description: PubMed

  Regulation

  • twofold induced by glucose PubMed

Biological materials

Mutant

• GP590 (pfkA::cat), available in Jörg Stülke's lab, PubMed
• GP595 (pfkA::erm), available in Jörg Stülke's lab, PubMed
• GP1744: BSB1 pfkA::aphA3, available in Jörg Stülke' lab
• GP1747: pfkA::aphA3, available in Jörg Stülke' lab, PubMed
• BKE29190 (pfkA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTCCATTCACCTCAGC,  downstream forward: _UP4_TAATGTACAGCTGAAGGCTG
• BKK29190 (pfkA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTCCATTCACCTCAGC,  downstream forward: _UP4_TAATGTACAGCTGAAGGCTG

Expression vectors

• for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP87, available in Jörg Stülke's lab, PubMed
• for expression/ purification from B. subtilis with C-terminal Strep-tag, for SPINE, in pGP382: pGP1266, available in Jörg Stülke's lab
• for expression/ purification from E. coli with N-terminal His-tag, in pWH844: pGP393, available in Jörg Stülke's lab
• for expression in B. subtilis, in pBQ200: pGP1422, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

FLAG-tag construct

• GP1019 (spc, based on pGP1331), available in Jörg Stülke's lab

LacZ fusion

• pGP511 (in pAC6), available in Jörg Stülke's lab

GFP fusion

• GP1720 (in pBP43), expression of  pfkA-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

Loading